Incidental Mutation 'R6536:Enpp2'
ID520437
Institutional Source Beutler Lab
Gene Symbol Enpp2
Ensembl Gene ENSMUSG00000022425
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 2
SynonymsPdnp2, Npps2, PD-Ialpha, ATX, Autotaxin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location54838901-54952892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54862631 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 583 (N583S)
Ref Sequence ENSEMBL: ENSMUSP00000128941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041591] [ENSMUST00000167541] [ENSMUST00000171545] [ENSMUST00000173516]
PDB Structure Crystal structure of mouse autotaxin [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 14:0-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 16:0-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 18:1-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 18:3-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 22:6-LPA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with Compound 10 [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 2BoA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 3BoA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 4BoA [X-RAY DIFFRACTION]
>> 4 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000041591
AA Change: N531S

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036180
Gene: ENSMUSG00000022425
AA Change: N531S

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 4.7e-41 PFAM
Pfam:Phosphodiest 278 477 3.3e-40 PFAM
Endonuclease_NS 613 844 3.93e-36 SMART
NUC 614 844 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167541
AA Change: N531S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132640
Gene: ENSMUSG00000022425
AA Change: N531S

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 284 5.4e-41 PFAM
Pfam:Phosphodiest 278 477 3.4e-40 PFAM
Endonuclease_NS 638 869 3.93e-36 SMART
NUC 639 869 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171545
AA Change: N583S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128941
Gene: ENSMUSG00000022425
AA Change: N583S

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 283 2.8e-43 PFAM
Pfam:Phosphodiest 275 529 2.8e-36 PFAM
Endonuclease_NS 665 896 3.93e-36 SMART
NUC 666 896 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173516
AA Change: N583S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133877
Gene: ENSMUSG00000022425
AA Change: N583S

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 2.8e-41 PFAM
Pfam:Phosphodiest 276 529 7.8e-36 PFAM
Endonuclease_NS 661 892 3.93e-36 SMART
NUC 662 892 1.32e-109 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228823
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a member of the phosphodiesterase and nucleotide pyrophosphatase family of bifunctional enzymes that hydrolize phosphodiester bonds of various nucleotides. The encoded protein undergoes proteolytic processing to generate a mature protein with lysophospholipase D activity, catalyzing the cleavage of the choline group from lysophosphatidylcholine to produce lysophosphatidic acid. This gene is expressed in numerous tissues and participates in neural development, obesity, inflammation and oncogenesis. A complete lack of the encoded protein in mice results in aberrant vascular and neuronal development leading to embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, absent yolk sac vasculature, abnormal vasculature, and variable penetrance of impaired embryo turning, edema, failure of chorioallantoic fusion, neural tube malformations, and abnormal forebrain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Enpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Enpp2 APN 15 54875650 critical splice donor site probably null
IGL01290:Enpp2 APN 15 54919602 missense possibly damaging 0.79
IGL01296:Enpp2 APN 15 54875669 missense probably damaging 1.00
IGL01650:Enpp2 APN 15 54919933 missense probably benign
IGL02470:Enpp2 APN 15 54839460 missense probably damaging 1.00
IGL02522:Enpp2 APN 15 54898940 missense probably damaging 0.99
IGL02727:Enpp2 APN 15 54910181 missense probably damaging 1.00
IGL03178:Enpp2 APN 15 54866006 missense probably benign
IGL03055:Enpp2 UTSW 15 54866085 splice site probably null
PIT4260001:Enpp2 UTSW 15 54844378 critical splice donor site probably null
R0302:Enpp2 UTSW 15 54860061 missense probably benign 0.15
R0304:Enpp2 UTSW 15 54877806 missense probably benign 0.07
R0385:Enpp2 UTSW 15 54882159 missense probably damaging 1.00
R0440:Enpp2 UTSW 15 54847237 splice site probably benign
R0696:Enpp2 UTSW 15 54897696 nonsense probably null
R0879:Enpp2 UTSW 15 54877930 missense probably damaging 0.98
R0924:Enpp2 UTSW 15 54906959 splice site probably benign
R0989:Enpp2 UTSW 15 54875759 missense possibly damaging 0.88
R1126:Enpp2 UTSW 15 54906826 critical splice donor site probably null
R1434:Enpp2 UTSW 15 54862681 missense probably damaging 1.00
R1447:Enpp2 UTSW 15 54919598 critical splice donor site probably null
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1501:Enpp2 UTSW 15 54839514 missense probably damaging 1.00
R1546:Enpp2 UTSW 15 54845829 missense probably benign 0.01
R1673:Enpp2 UTSW 15 54910196 splice site probably null
R1853:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1854:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1855:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1969:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R1970:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R2060:Enpp2 UTSW 15 54875714 missense probably damaging 1.00
R2122:Enpp2 UTSW 15 54897792 nonsense probably null
R2275:Enpp2 UTSW 15 54897794 missense probably damaging 1.00
R2517:Enpp2 UTSW 15 54919694 missense probably damaging 0.99
R3881:Enpp2 UTSW 15 54919692 missense probably damaging 1.00
R3934:Enpp2 UTSW 15 54845921 missense probably benign 0.03
R4722:Enpp2 UTSW 15 54887589 missense probably damaging 0.99
R4765:Enpp2 UTSW 15 54875672 missense possibly damaging 0.91
R4799:Enpp2 UTSW 15 54910094 missense probably damaging 1.00
R4934:Enpp2 UTSW 15 54882147 missense probably damaging 1.00
R4976:Enpp2 UTSW 15 54870305 nonsense probably null
R5068:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5069:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5070:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5119:Enpp2 UTSW 15 54870305 nonsense probably null
R5134:Enpp2 UTSW 15 54899330 missense probably damaging 1.00
R5162:Enpp2 UTSW 15 54847296 missense probably benign 0.06
R5218:Enpp2 UTSW 15 54887586 missense possibly damaging 0.86
R5415:Enpp2 UTSW 15 54882156 missense probably damaging 1.00
R5965:Enpp2 UTSW 15 54882971 critical splice donor site probably null
R6086:Enpp2 UTSW 15 54845834 missense probably damaging 1.00
R6229:Enpp2 UTSW 15 54877832 missense probably damaging 1.00
R6306:Enpp2 UTSW 15 54899346 missense probably damaging 1.00
R6314:Enpp2 UTSW 15 54865970 missense probably damaging 0.99
R6403:Enpp2 UTSW 15 54863764 missense probably damaging 1.00
R6515:Enpp2 UTSW 15 54860093 missense possibly damaging 0.75
R6525:Enpp2 UTSW 15 54870211 missense probably benign 0.01
R7070:Enpp2 UTSW 15 54899289 missense probably damaging 1.00
R7077:Enpp2 UTSW 15 54901391 missense probably benign 0.36
R7265:Enpp2 UTSW 15 54910033 critical splice donor site probably null
R7324:Enpp2 UTSW 15 54877774 critical splice donor site probably null
R7331:Enpp2 UTSW 15 54875670 missense probably damaging 1.00
R7452:Enpp2 UTSW 15 54866736 missense probably damaging 0.99
R7494:Enpp2 UTSW 15 54910158 missense probably damaging 1.00
R7557:Enpp2 UTSW 15 54910140 missense probably damaging 1.00
R7574:Enpp2 UTSW 15 54851417 missense probably benign
R7665:Enpp2 UTSW 15 54839394 missense probably damaging 0.98
R7744:Enpp2 UTSW 15 54901233 splice site probably null
R7940:Enpp2 UTSW 15 54906928 missense probably damaging 1.00
R7942:Enpp2 UTSW 15 54845879 missense probably damaging 1.00
R7951:Enpp2 UTSW 15 54919693 missense probably benign 0.00
R8069:Enpp2 UTSW 15 54847301 missense probably damaging 0.96
R8301:Enpp2 UTSW 15 54851407 missense probably benign
R8376:Enpp2 UTSW 15 54910095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGCTCCATTTTAGATGTCGG -3'
(R):5'- TGTGCAAGGAATGGCTGAC -3'

Sequencing Primer
(F):5'- GATGTCGGAGTCAAAAATCAACTC -3'
(R):5'- TGCAAGGAATGGCTGACGTAATTTAG -3'
Posted On2018-06-06