Incidental Mutation 'R6536:Cd320'
ID520439
Institutional Source Beutler Lab
Gene Symbol Cd320
Ensembl Gene ENSMUSG00000002308
Gene NameCD320 antigen
SynonymsVLDL, NG29, D17Ertd716e, 8D6, 425O18-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R6536 (G1)
Quality Score205.009
Status Validated
Chromosome17
Chromosomal Location33843091-33849774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33847503 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 72 (S72P)
Ref Sequence ENSEMBL: ENSMUSP00000084839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002379] [ENSMUST00000087559]
Predicted Effect probably benign
Transcript: ENSMUST00000002379
AA Change: S86P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002379
Gene: ENSMUSG00000002308
AA Change: S86P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LDLa 46 84 1.16e-14 SMART
LDLa 123 161 4.24e-8 SMART
transmembrane domain 207 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087559
AA Change: S72P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084839
Gene: ENSMUSG00000002308
AA Change: S72P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LDLa 32 70 1.16e-14 SMART
LDLa 109 147 4.24e-8 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173418
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the transcobalamin receptor that is expressed at the cell surface. It mediates the cellular uptake of transcobalamin bound cobalamin (vitamin B12), and is involved in B-cell proliferation and immunoglobulin secretion. Mutations in this gene are associated with methylmalonic aciduria. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: The homozygous mutant and heterozygous mice exhibited an increased mean retinal artery-to-vein ratio when compared with controls. Mice homozygous for a gene trap knock-out allele exhibit vitamin B12 deficiency in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Cd320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Cd320 APN 17 33843240 unclassified probably benign
R0107:Cd320 UTSW 17 33848085 missense probably benign
R0722:Cd320 UTSW 17 33846030 missense possibly damaging 0.65
R1272:Cd320 UTSW 17 33848164 missense possibly damaging 0.53
R1515:Cd320 UTSW 17 33847639 missense probably damaging 1.00
R4062:Cd320 UTSW 17 33847517 missense probably benign 0.08
R4663:Cd320 UTSW 17 33848178 missense probably null 1.00
R4981:Cd320 UTSW 17 33847575 missense probably benign 0.00
R5516:Cd320 UTSW 17 33848047 missense possibly damaging 0.95
R6376:Cd320 UTSW 17 33847517 missense probably benign 0.08
R6600:Cd320 UTSW 17 33847617 missense probably damaging 1.00
R7417:Cd320 UTSW 17 33847556 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGATTTAGAGCGGATTGGGTAAC -3'
(R):5'- CTGGAGTCAAGACAGTCTGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- AAGACAGTCTGGGTGGCCATC -3'
Posted On2018-06-06