Incidental Mutation 'R6536:Usp49'
ID520443
Institutional Source Beutler Lab
Gene Symbol Usp49
Ensembl Gene ENSMUSG00000090115
Gene Nameubiquitin specific peptidase 49
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47630690-47686738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47679692 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 348 (I348F)
Ref Sequence ENSEMBL: ENSMUSP00000120034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024779] [ENSMUST00000132397] [ENSMUST00000152724]
Predicted Effect probably damaging
Transcript: ENSMUST00000024779
AA Change: I564F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024779
Gene: ENSMUSG00000090115
AA Change: I564F

DomainStartEndE-ValueType
ZnF_UBP 25 74 4.21e-17 SMART
coiled coil region 165 203 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
Pfam:UCH 249 651 5.4e-61 PFAM
Pfam:UCH_1 337 633 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131550
Predicted Effect probably benign
Transcript: ENSMUST00000132397
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152724
AA Change: I348F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120034
Gene: ENSMUSG00000090115
AA Change: I348F

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:UCH 33 374 2.5e-40 PFAM
Pfam:UCH_1 119 374 1.5e-10 PFAM
Meta Mutation Damage Score 0.8722 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Usp49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00721:Usp49 APN 17 47680703 missense probably damaging 1.00
R0605:Usp49 UTSW 17 47674926 splice site probably null
R0919:Usp49 UTSW 17 47672451 missense probably benign 0.17
R1167:Usp49 UTSW 17 47672226 missense possibly damaging 0.94
R1675:Usp49 UTSW 17 47673410 missense probably damaging 1.00
R1733:Usp49 UTSW 17 47672313 missense probably damaging 1.00
R2344:Usp49 UTSW 17 47672903 missense probably damaging 1.00
R3737:Usp49 UTSW 17 47672318 missense probably damaging 1.00
R4078:Usp49 UTSW 17 47674749 missense probably damaging 1.00
R5079:Usp49 UTSW 17 47673221 missense possibly damaging 0.77
R6197:Usp49 UTSW 17 47673347 missense possibly damaging 0.66
R6244:Usp49 UTSW 17 47672902 nonsense probably null
R6303:Usp49 UTSW 17 47680822 missense probably damaging 0.98
R7207:Usp49 UTSW 17 47678877 missense probably benign 0.06
R7304:Usp49 UTSW 17 47672871 missense possibly damaging 0.78
R7418:Usp49 UTSW 17 47672168 nonsense probably null
R7508:Usp49 UTSW 17 47672280 missense probably benign 0.44
R7648:Usp49 UTSW 17 47674828 missense possibly damaging 0.93
R7705:Usp49 UTSW 17 47678948 missense probably damaging 1.00
R8529:Usp49 UTSW 17 47672112 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGATACTCCATGGAGCTGTCATAG -3'
(R):5'- GAACAGACCAACCCTTTTCCTTG -3'

Sequencing Primer
(F):5'- GTCATAGCAGATATCCACACGAATTG -3'
(R):5'- GGGTAAAGCACACGCACCTC -3'
Posted On2018-06-06