Incidental Mutation 'R6537:Znhit6'
ID520456
Institutional Source Beutler Lab
Gene Symbol Znhit6
Ensembl Gene ENSMUSG00000074182
Gene Namezinc finger, HIT type 6
Synonyms2410019A14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6537 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location145576205-145604795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145594619 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 193 (I193V)
Ref Sequence ENSEMBL: ENSMUSP00000143306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098534] [ENSMUST00000196413] [ENSMUST00000197604] [ENSMUST00000199033]
Predicted Effect probably benign
Transcript: ENSMUST00000098534
AA Change: I361V

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096136
Gene: ENSMUSG00000074182
AA Change: I361V

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 118 150 N/A INTRINSIC
Pfam:zf-HIT 208 237 4.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196413
AA Change: I217V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143376
Gene: ENSMUSG00000074182
AA Change: I217V

DomainStartEndE-ValueType
Pfam:zf-HIT 64 93 3.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197474
Predicted Effect probably benign
Transcript: ENSMUST00000197604
SMART Domains Protein: ENSMUSP00000143484
Gene: ENSMUSG00000074182

DomainStartEndE-ValueType
Pfam:zf-HIT 40 69 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199033
AA Change: I193V

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143306
Gene: ENSMUSG00000074182
AA Change: I193V

DomainStartEndE-ValueType
Pfam:zf-HIT 40 69 4.7e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 T C 5: 52,843,556 S224P probably damaging Het
Col6a4 G A 9: 106,067,954 T987M possibly damaging Het
Cort C T 4: 149,126,624 G8E probably benign Het
Ctdp1 G T 18: 80,449,551 D576E probably benign Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
Cwc15 A G 9: 14,501,988 D22G probably damaging Het
Dnmt3l G A 10: 78,052,064 G136R probably null Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fxyd6 A G 9: 45,390,794 I37V possibly damaging Het
Gm10604 A C 4: 11,980,221 S28A unknown Het
Gm43302 A G 5: 105,290,995 I9T possibly damaging Het
Hmcn2 T C 2: 31,415,268 V3151A probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Kyat3 A G 3: 142,729,812 T282A probably benign Het
Lrp6 T C 6: 134,480,495 E782G probably benign Het
Lrrc3b T C 14: 15,357,946 Y220C probably damaging Het
Macf1 C T 4: 123,492,725 S1033N probably damaging Het
Mdm1 A G 10: 118,158,576 T452A probably benign Het
Nrn1l G T 8: 105,894,718 R99L probably damaging Het
Pappa T A 4: 65,297,282 I1142N probably damaging Het
Pcsk1 T C 13: 75,132,239 F728L probably damaging Het
Ptcd3 T C 6: 71,897,110 probably null Het
Siglecf C T 7: 43,355,999 T461I probably benign Het
Slc7a8 C T 14: 54,735,119 A282T probably benign Het
Srcap T C 7: 127,542,220 V1724A probably damaging Het
Tek A G 4: 94,837,324 Q609R probably benign Het
Trim45 C T 3: 100,925,396 A315V probably benign Het
Ttbk1 C T 17: 46,470,310 V446M probably damaging Het
Wrap53 T C 11: 69,563,868 D225G possibly damaging Het
Other mutations in Znhit6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Znhit6 APN 3 145578160 missense probably damaging 1.00
IGL00969:Znhit6 APN 3 145594596 splice site probably benign
IGL01588:Znhit6 APN 3 145596207 splice site probably benign
IGL01911:Znhit6 APN 3 145578098 splice site probably benign
IGL02118:Znhit6 APN 3 145578104 missense probably damaging 1.00
R1066:Znhit6 UTSW 3 145578497 missense probably damaging 1.00
R1115:Znhit6 UTSW 3 145594685 splice site probably null
R2278:Znhit6 UTSW 3 145576236 unclassified probably benign
R2391:Znhit6 UTSW 3 145594658 missense probably damaging 1.00
R2656:Znhit6 UTSW 3 145578169 critical splice donor site probably null
R2877:Znhit6 UTSW 3 145576654 missense probably benign 0.31
R3825:Znhit6 UTSW 3 145578344 missense probably benign 0.17
R4636:Znhit6 UTSW 3 145600578 splice site silent
R4636:Znhit6 UTSW 3 145600579 missense probably null 0.11
R5295:Znhit6 UTSW 3 145600493 missense probably benign 0.41
R5964:Znhit6 UTSW 3 145576933 missense possibly damaging 0.66
R5965:Znhit6 UTSW 3 145578348 missense possibly damaging 0.80
X0065:Znhit6 UTSW 3 145578486 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTAGAAAGTCTGTCTGTGC -3'
(R):5'- GGCACTAGTTTTACAGTGACTGAAC -3'

Sequencing Primer
(F):5'- CTAGAAAGTCTGTCTGTGCTTTTC -3'
(R):5'- GTCTAAGTTCCAACTCTGAGAGGC -3'
Posted On2018-06-06