Incidental Mutation 'R6537:Gm10604'
ID520458
Institutional Source Beutler Lab
Gene Symbol Gm10604
Ensembl Gene ENSMUSG00000073995
Gene Namepredicted gene 10604
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6537 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11979560-11981265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 11980221 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 28 (S28A)
Ref Sequence ENSEMBL: ENSMUSP00000095860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098260]
Predicted Effect unknown
Transcript: ENSMUST00000098260
AA Change: S28A
SMART Domains Protein: ENSMUSP00000095860
Gene: ENSMUSG00000073995
AA Change: S28A

DomainStartEndE-ValueType
SCOP:d1kcma_ 2 72 5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181295
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 T C 5: 52,843,556 S224P probably damaging Het
Col6a4 G A 9: 106,067,954 T987M possibly damaging Het
Cort C T 4: 149,126,624 G8E probably benign Het
Ctdp1 G T 18: 80,449,551 D576E probably benign Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
Cwc15 A G 9: 14,501,988 D22G probably damaging Het
Dnmt3l G A 10: 78,052,064 G136R probably null Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fxyd6 A G 9: 45,390,794 I37V possibly damaging Het
Gm43302 A G 5: 105,290,995 I9T possibly damaging Het
Hmcn2 T C 2: 31,415,268 V3151A probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Kyat3 A G 3: 142,729,812 T282A probably benign Het
Lrp6 T C 6: 134,480,495 E782G probably benign Het
Lrrc3b T C 14: 15,357,946 Y220C probably damaging Het
Macf1 C T 4: 123,492,725 S1033N probably damaging Het
Mdm1 A G 10: 118,158,576 T452A probably benign Het
Nrn1l G T 8: 105,894,718 R99L probably damaging Het
Pappa T A 4: 65,297,282 I1142N probably damaging Het
Pcsk1 T C 13: 75,132,239 F728L probably damaging Het
Ptcd3 T C 6: 71,897,110 probably null Het
Siglecf C T 7: 43,355,999 T461I probably benign Het
Slc7a8 C T 14: 54,735,119 A282T probably benign Het
Srcap T C 7: 127,542,220 V1724A probably damaging Het
Tek A G 4: 94,837,324 Q609R probably benign Het
Trim45 C T 3: 100,925,396 A315V probably benign Het
Ttbk1 C T 17: 46,470,310 V446M probably damaging Het
Wrap53 T C 11: 69,563,868 D225G possibly damaging Het
Znhit6 A G 3: 145,594,619 I193V probably benign Het
Other mutations in Gm10604
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1906:Gm10604 UTSW 4 11979989 missense unknown
R2504:Gm10604 UTSW 4 11980083 missense unknown
R2923:Gm10604 UTSW 4 11980122 missense unknown
R7243:Gm10604 UTSW 4 11980113 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTGTAGGCCATCACCTTGAAC -3'
(R):5'- ACCTGGTATCCAACTGAAGTC -3'

Sequencing Primer
(F):5'- GTGTAGGCCATCACCTTGAACAAAAC -3'
(R):5'- TGGTATCCAACTGAAGTCACACAAAG -3'
Posted On2018-06-06