Mutagenetix > Incidental Mutations

Incidental Mutation 'R6537:Lrp6'

520474

Institutional Source

Beutler Lab

Gene Symbol

Lrp6

Ensembl Gene

ENSMUSG00000030201

Gene Name

low density lipoprotein receptor-related protein 6

Synonyms

skax26, Cd, ska26, ska

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R6537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134446476-134566965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134480495 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 782 (E782G)

Ref Sequence

ENSEMBL: ENSMUSP00000032322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032322]

Predicted Effect

probably benign
Transcript: ENSMUST00000032322
AA Change: E782G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: E782G

Domain	Start	End	E-Value	Type
LY	43	85	1.55e-2	SMART
LY	87	129	1.91e-11	SMART
LY	130	173	5.19e-13	SMART
LY	174	216	1.39e-13	SMART
LY	217	258	2.87e-6	SMART
EGF	285	324	2.16e-1	SMART
low complexity region	330	341	N/A	INTRINSIC
LY	352	394	1.29e-8	SMART
LY	395	437	5.73e-15	SMART
LY	438	481	1.07e-14	SMART
LY	482	524	3.07e-15	SMART
LY	525	565	4.66e-6	SMART
EGF	591	628	1.47e-3	SMART
LY	654	696	2.06e-7	SMART
LY	697	739	3.73e-14	SMART
LY	740	783	3.37e-12	SMART
LY	784	825	1.17e-6	SMART
LY	827	865	1.91e-2	SMART
EGF	892	930	7.35e-4	SMART
LY	957	999	1.41e-5	SMART
LY	1005	1048	5.32e-1	SMART
LY	1049	1093	5e-6	SMART
LY	1094	1136	4.25e-9	SMART
LY	1137	1177	1.91e-2	SMART
EGF	1206	1250	1.23e1	SMART
LDLa	1248	1287	2.42e-12	SMART
LDLa	1288	1324	4.37e-10	SMART
LDLa	1325	1362	1.66e-10	SMART
transmembrane domain	1371	1393	N/A	INTRINSIC
low complexity region	1429	1438	N/A	INTRINSIC
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1566	1573	N/A	INTRINSIC
low complexity region	1596	1608	N/A	INTRINSIC

Meta Mutation Damage Score

0.1277

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc4	T	C	5: 52,843,556	S224P	probably damaging	Het
Col6a4	G	A	9: 106,067,954	T987M	possibly damaging	Het
Cort	C	T	4: 149,126,624	G8E	probably benign	Het
Ctdp1	G	T	18: 80,449,551	D576E	probably benign	Het
Ctsq	A	T	13: 61,035,326	I334N	probably damaging	Het
Cwc15	A	G	9: 14,501,988	D22G	probably damaging	Het
Dnmt3l	G	A	10: 78,052,064	G136R	probably null	Het
Fam19a2	T	A	10: 123,593,496	M5K	possibly damaging	Het
Fxyd6	A	G	9: 45,390,794	I37V	possibly damaging	Het
Gm10604	A	C	4: 11,980,221	S28A	unknown	Het
Gm43302	A	G	5: 105,290,995	I9T	possibly damaging	Het
Hmcn2	T	C	2: 31,415,268	V3151A	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Kyat3	A	G	3: 142,729,812	T282A	probably benign	Het
Lrrc3b	T	C	14: 15,357,946	Y220C	probably damaging	Het
Macf1	C	T	4: 123,492,725	S1033N	probably damaging	Het
Mdm1	A	G	10: 118,158,576	T452A	probably benign	Het
Nrn1l	G	T	8: 105,894,718	R99L	probably damaging	Het
Pappa	T	A	4: 65,297,282	I1142N	probably damaging	Het
Pcsk1	T	C	13: 75,132,239	F728L	probably damaging	Het
Ptcd3	T	C	6: 71,897,110		probably null	Het
Siglecf	C	T	7: 43,355,999	T461I	probably benign	Het
Slc7a8	C	T	14: 54,735,119	A282T	probably benign	Het
Srcap	T	C	7: 127,542,220	V1724A	probably damaging	Het
Tek	A	G	4: 94,837,324	Q609R	probably benign	Het
Trim45	C	T	3: 100,925,396	A315V	probably benign	Het
Ttbk1	C	T	17: 46,470,310	V446M	probably damaging	Het
Wrap53	T	C	11: 69,563,868	D225G	possibly damaging	Het
Znhit6	A	G	3: 145,594,619	I193V	probably benign	Het

Other mutations in Lrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Lrp6	APN	6	134456090	missense	probably benign	0.17
IGL00765:Lrp6	APN	6	134541854	missense	probably benign	0.02
IGL00898:Lrp6	APN	6	134479739	missense	probably damaging	0.99
IGL00916:Lrp6	APN	6	134484289	missense	probably damaging	1.00
IGL00961:Lrp6	APN	6	134507646	missense	probably damaging	0.98
IGL01620:Lrp6	APN	6	134511262	missense	probably damaging	1.00
IGL01765:Lrp6	APN	6	134456145	missense	probably damaging	0.99
IGL02066:Lrp6	APN	6	134450937	nonsense	probably null
IGL02067:Lrp6	APN	6	134480396	missense	probably damaging	0.99
IGL02169:Lrp6	APN	6	134513327	missense	probably damaging	0.96
IGL02281:Lrp6	APN	6	134457734	missense	probably benign	0.40
IGL02484:Lrp6	APN	6	134541923	missense	probably benign	0.15
IGL02724:Lrp6	APN	6	134484265	missense	probably damaging	1.00
IGL02876:Lrp6	APN	6	134456114	missense	probably benign	0.43
IGL03011:Lrp6	APN	6	134520417	missense	possibly damaging	0.80
IGL03352:Lrp6	APN	6	134479763	missense	probably damaging	1.00
Coiled	UTSW	6	134507558	nonsense	probably null
BB004:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
BB014:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
PIT4494001:Lrp6	UTSW	6	134479778	missense	probably damaging	1.00
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0008:Lrp6	UTSW	6	134485753	missense	probably damaging	0.96
R0201:Lrp6	UTSW	6	134450897	nonsense	probably null
R0295:Lrp6	UTSW	6	134457693	missense	probably benign	0.02
R0370:Lrp6	UTSW	6	134479766	missense	probably damaging	1.00
R0382:Lrp6	UTSW	6	134467668	missense	probably damaging	1.00
R0413:Lrp6	UTSW	6	134507624	missense	probably damaging	0.99
R0468:Lrp6	UTSW	6	134485661	missense	possibly damaging	0.94
R0492:Lrp6	UTSW	6	134480518	missense	possibly damaging	0.58
R0584:Lrp6	UTSW	6	134456076	missense	probably damaging	0.99
R0631:Lrp6	UTSW	6	134479775	missense	possibly damaging	0.95
R0738:Lrp6	UTSW	6	134542045	missense	probably benign	0.13
R0907:Lrp6	UTSW	6	134507525	missense	probably damaging	0.96
R1273:Lrp6	UTSW	6	134467507	critical splice donor site	probably null
R1548:Lrp6	UTSW	6	134459429	missense	possibly damaging	0.89
R1639:Lrp6	UTSW	6	134453566	missense	possibly damaging	0.68
R1650:Lrp6	UTSW	6	134468769	missense	probably benign	0.01
R1696:Lrp6	UTSW	6	134468723	missense	probably damaging	1.00
R1751:Lrp6	UTSW	6	134464568	missense	probably damaging	1.00
R1780:Lrp6	UTSW	6	134464451	missense	probably damaging	0.99
R2013:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2015:Lrp6	UTSW	6	134480374	critical splice donor site	probably null
R2165:Lrp6	UTSW	6	134459283	missense	probably damaging	1.00
R2294:Lrp6	UTSW	6	134457742	missense	probably damaging	1.00
R2336:Lrp6	UTSW	6	134507583	missense	probably damaging	0.97
R2964:Lrp6	UTSW	6	134467526	missense	probably damaging	1.00
R3716:Lrp6	UTSW	6	134507447	missense	probably damaging	1.00
R4017:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R4370:Lrp6	UTSW	6	134506358	nonsense	probably null
R4521:Lrp6	UTSW	6	134485862	missense	probably damaging	1.00
R4573:Lrp6	UTSW	6	134470730	nonsense	probably null
R4645:Lrp6	UTSW	6	134484250	missense	probably damaging	1.00
R4661:Lrp6	UTSW	6	134511267	missense	probably benign
R4688:Lrp6	UTSW	6	134479743	missense	probably damaging	1.00
R4784:Lrp6	UTSW	6	134479539	missense	probably benign	0.06
R5236:Lrp6	UTSW	6	134511264	missense	probably damaging	1.00
R5506:Lrp6	UTSW	6	134459296	missense	probably benign	0.09
R5508:Lrp6	UTSW	6	134464516	missense	probably benign	0.31
R6001:Lrp6	UTSW	6	134464518	missense	probably benign	0.03
R6319:Lrp6	UTSW	6	134541835	missense	possibly damaging	0.46
R6552:Lrp6	UTSW	6	134454729	missense	probably benign	0.17
R6559:Lrp6	UTSW	6	134513254	missense	probably damaging	1.00
R6575:Lrp6	UTSW	6	134541971	missense	possibly damaging	0.80
R6585:Lrp6	UTSW	6	134507558	nonsense	probably null
R6700:Lrp6	UTSW	6	134479560	missense	probably damaging	1.00
R6724:Lrp6	UTSW	6	134486541	missense	possibly damaging	0.94
R7159:Lrp6	UTSW	6	134507551	missense	probably benign
R7266:Lrp6	UTSW	6	134507401	missense	probably damaging	1.00
R7339:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7341:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7342:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7348:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7359:Lrp6	UTSW	6	134450960	nonsense	probably null
R7366:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7368:Lrp6	UTSW	6	134450818	missense	probably damaging	1.00
R7501:Lrp6	UTSW	6	134486508	missense	probably damaging	1.00
R7548:Lrp6	UTSW	6	134507508	missense	probably damaging	0.97
R7652:Lrp6	UTSW	6	134511245	nonsense	probably null
R7771:Lrp6	UTSW	6	134462616	missense	probably damaging	1.00
R7927:Lrp6	UTSW	6	134520550	missense	probably damaging	1.00
R8717:Lrp6	UTSW	6	134457748	missense	not run
R8726:Lrp6	UTSW	6	134507661	nonsense	probably null
R8792:Lrp6	UTSW	6	134486586	missense	not run
R8812:Lrp6	UTSW	6	134456178	missense	not run
Z1176:Lrp6	UTSW	6	134456157	missense	possibly damaging	0.72
Z1177:Lrp6	UTSW	6	134462541	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCCAGTGAGTTTCCATAAAC -3'
(R):5'- GGCACAGTTAGCTGGAGATGAC -3'

Sequencing Primer
(F):5'- GTGAGTTTCCATAAACACCTAAGC -3'
(R):5'- CAGGTTTATGTATTGGACTGAG -3'

Posted On

2018-06-06