Incidental Mutation 'R6495:Cyp39a1'
ID520481
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Namecytochrome P450, family 39, subfamily a, polypeptide 1
Synonymsoxysterol 7-alpha-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location43667425-43751431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43691694 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 267 (Y267H)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
Predicted Effect probably benign
Transcript: ENSMUST00000170988
AA Change: Y267H

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: Y267H

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Meta Mutation Damage Score 0.2689 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGACACAGTATCTCTCGG -3'
(R):5'- CCAAAGTGTGTGAAGAATTGAAGTCC -3'

Sequencing Primer
(F):5'- TATCCCTAACACTGGGTAGAGGCTG -3'
(R):5'- TGTGTGAAGAATTGAAGTCCAAGAG -3'
Posted On2018-06-06