Mutagenetix > Incidental Mutations

Incidental Mutation 'R6537:Dnmt3l'

520488

Institutional Source

Beutler Lab

Gene Symbol

Dnmt3l

Ensembl Gene

ENSMUSG00000000730

Gene Name

DNA (cytosine-5-)-methyltransferase 3-like

Synonyms

D6Ertd14e, ecat7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78041947-78063622 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 78052064 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 136 (G136R)

Ref Sequence

ENSEMBL: ENSMUSP00000116970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000746] [ENSMUST00000123940] [ENSMUST00000131825] [ENSMUST00000138785] [ENSMUST00000139539] [ENSMUST00000151242]

Predicted Effect

probably null
Transcript: ENSMUST00000000746
AA Change: G136R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000746
Gene: ENSMUSG00000000730
AA Change: G136R

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000123940

SMART Domains

Protein: ENSMUSP00000123015
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000131825

SMART Domains

Protein: ENSMUSP00000119571
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000138785
AA Change: G136R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730
AA Change: G136R

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000139539

SMART Domains

Protein: ENSMUSP00000117827
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144446

Predicted Effect

probably null
Transcript: ENSMUST00000151242
AA Change: G136R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116970
Gene: ENSMUSG00000000730
AA Change: G136R

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Meta Mutation Damage Score

0.4977

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutants in this imprinted gene lack appropriate methylation of the maternal allele and this, in turn, causes azoospermia in homozygous males; and heterozygous progeny of homozygous females die by midgestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc4	T	C	5: 52,843,556	S224P	probably damaging	Het
Col6a4	G	A	9: 106,067,954	T987M	possibly damaging	Het
Cort	C	T	4: 149,126,624	G8E	probably benign	Het
Ctdp1	G	T	18: 80,449,551	D576E	probably benign	Het
Ctsq	A	T	13: 61,035,326	I334N	probably damaging	Het
Cwc15	A	G	9: 14,501,988	D22G	probably damaging	Het
Fam19a2	T	A	10: 123,593,496	M5K	possibly damaging	Het
Fxyd6	A	G	9: 45,390,794	I37V	possibly damaging	Het
Gm10604	A	C	4: 11,980,221	S28A	unknown	Het
Gm43302	A	G	5: 105,290,995	I9T	possibly damaging	Het
Hmcn2	T	C	2: 31,415,268	V3151A	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Kyat3	A	G	3: 142,729,812	T282A	probably benign	Het
Lrp6	T	C	6: 134,480,495	E782G	probably benign	Het
Lrrc3b	T	C	14: 15,357,946	Y220C	probably damaging	Het
Macf1	C	T	4: 123,492,725	S1033N	probably damaging	Het
Mdm1	A	G	10: 118,158,576	T452A	probably benign	Het
Nrn1l	G	T	8: 105,894,718	R99L	probably damaging	Het
Pappa	T	A	4: 65,297,282	I1142N	probably damaging	Het
Pcsk1	T	C	13: 75,132,239	F728L	probably damaging	Het
Ptcd3	T	C	6: 71,897,110		probably null	Het
Siglecf	C	T	7: 43,355,999	T461I	probably benign	Het
Slc7a8	C	T	14: 54,735,119	A282T	probably benign	Het
Srcap	T	C	7: 127,542,220	V1724A	probably damaging	Het
Tek	A	G	4: 94,837,324	Q609R	probably benign	Het
Trim45	C	T	3: 100,925,396	A315V	probably benign	Het
Ttbk1	C	T	17: 46,470,310	V446M	probably damaging	Het
Wrap53	T	C	11: 69,563,868	D225G	possibly damaging	Het
Znhit6	A	G	3: 145,594,619	I193V	probably benign	Het

Other mutations in Dnmt3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Dnmt3l	APN	10	78057355	missense	probably damaging	1.00
IGL00827:Dnmt3l	APN	10	78053996	missense	probably damaging	1.00
IGL01072:Dnmt3l	APN	10	78052771	missense	probably benign	0.09
IGL01118:Dnmt3l	APN	10	78057286	missense	probably damaging	0.97
IGL01553:Dnmt3l	APN	10	78063248	missense	probably benign	0.00
IGL02322:Dnmt3l	APN	10	78052738	missense	possibly damaging	0.90
IGL02323:Dnmt3l	APN	10	78063318	missense	probably damaging	1.00
IGL02618:Dnmt3l	APN	10	78054022	splice site	probably benign
IGL02701:Dnmt3l	APN	10	78055022	missense	probably benign	0.01
IGL02950:Dnmt3l	APN	10	78050951	missense	probably benign	0.01
R0318:Dnmt3l	UTSW	10	78055055	missense	probably damaging	1.00
R0384:Dnmt3l	UTSW	10	78052737	missense	possibly damaging	0.95
R0391:Dnmt3l	UTSW	10	78051916	splice site	probably benign
R1144:Dnmt3l	UTSW	10	78051905	missense	probably damaging	1.00
R2069:Dnmt3l	UTSW	10	78052732	missense	probably damaging	1.00
R2115:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R2116:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R2117:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R4812:Dnmt3l	UTSW	10	78057294	missense	probably benign	0.06
R5001:Dnmt3l	UTSW	10	78059731	missense	probably null	1.00
R5039:Dnmt3l	UTSW	10	78052900	intron	probably null
R5389:Dnmt3l	UTSW	10	78056831	splice site	probably null
R5799:Dnmt3l	UTSW	10	78052026	missense	possibly damaging	0.71
R5811:Dnmt3l	UTSW	10	78052095	missense	possibly damaging	0.78
R5875:Dnmt3l	UTSW	10	78053938	missense	probably benign
R6314:Dnmt3l	UTSW	10	78059687	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTGCCCCATGTAAGGTAAG -3'
(R):5'- AATGAGCTGCCTATTCCCTGG -3'

Sequencing Primer
(F):5'- TGCCCCATGTAAGGTAAGTAGGG -3'
(R):5'- TGGACCCACCATATTGCTTAAG -3'

Posted On

2018-06-06