Incidental Mutation 'R6514:Duoxa1'
ID520491
Institutional Source Beutler Lab
Gene Symbol Duoxa1
Ensembl Gene ENSMUSG00000027224
Gene Namedual oxidase maturation factor 1
SynonymsNip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6514 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122302191-122313730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122304713 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 184 (S184P)
Ref Sequence ENSEMBL: ENSMUSP00000106167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028653] [ENSMUST00000028656] [ENSMUST00000110537] [ENSMUST00000110538] [ENSMUST00000147788] [ENSMUST00000148417] [ENSMUST00000154412]
Predicted Effect probably benign
Transcript: ENSMUST00000028653
AA Change: S229P

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028653
Gene: ENSMUSG00000027224
AA Change: S229P

DomainStartEndE-ValueType
Pfam:DuoxA 10 287 7.2e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028656
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110537
AA Change: S229P

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106166
Gene: ENSMUSG00000027224
AA Change: S229P

DomainStartEndE-ValueType
Pfam:DuoxA 9 290 3.9e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110538
AA Change: S184P

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106167
Gene: ENSMUSG00000027224
AA Change: S184P

DomainStartEndE-ValueType
Pfam:DuoxA 9 70 1.7e-23 PFAM
Pfam:DuoxA 67 245 2.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147788
SMART Domains Protein: ENSMUSP00000116280
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 134 5.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148417
SMART Domains Protein: ENSMUSP00000116963
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 210 1.2e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154412
SMART Domains Protein: ENSMUSP00000116911
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 100 6.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155561
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele of Duoxa1 and 2 exhibit severe hypothyrodism with severe postnatal growth, delayed eye opening, enlarged thyroid, enlarged adenohypophysis, respiratory distress and death at weaning when weaned at 21 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik G A 11: 50,942,742 A11V unknown Het
Add1 T A 5: 34,605,973 H168Q probably damaging Het
Apol7b C T 15: 77,423,926 R123Q probably benign Het
Arrdc3 A G 13: 80,889,190 E155G probably damaging Het
Capn7 T G 14: 31,344,554 D108E probably benign Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cntnap5c A G 17: 58,330,170 E1014G probably damaging Het
Crybg1 A T 10: 43,997,215 L1299H probably damaging Het
Ech1 A G 7: 28,826,015 H65R possibly damaging Het
Egr3 T C 14: 70,078,917 L59P probably damaging Het
Eif4enif1 T A 11: 3,240,996 D724E probably null Het
Erbb2 A G 11: 98,420,146 D44G probably benign Het
Fer1l5 A G 1: 36,403,616 I739V probably benign Het
Gfm1 T C 3: 67,473,546 F665L probably benign Het
Gm10801 T A 2: 98,663,869 W119R probably benign Het
H2-M11 A T 17: 36,548,947 E277D probably damaging Het
Ighv1-66 T C 12: 115,593,120 Y114C possibly damaging Het
Irf1 C G 11: 53,771,322 L12V probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Ly6g C T 15: 75,156,732 P14S probably benign Het
Mfsd13a T C 19: 46,374,625 probably null Het
Mme T A 3: 63,364,844 C621* probably null Het
Mmp16 T C 4: 18,116,123 C576R probably damaging Het
Ngp A T 9: 110,419,949 I30F probably damaging Het
Olfr450 T A 6: 42,817,996 I175N probably damaging Het
Pdcd6ip G A 9: 113,689,694 T166I probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Plcb4 T A 2: 135,954,996 H440Q probably benign Het
Ppl A G 16: 5,087,317 S1705P probably damaging Het
Ryr1 A G 7: 29,046,841 F3831S probably damaging Het
Serpine2 A C 1: 79,821,570 probably null Het
Skor2 T A 18: 76,862,694 W906R probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Ufl1 T A 4: 25,262,238 D336V probably damaging Het
Vav1 T C 17: 57,327,660 F832L probably damaging Het
Other mutations in Duoxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Duoxa1 APN 2 122304646 missense probably benign 0.35
Minima UTSW 2 122303837 missense probably damaging 1.00
nadir UTSW 2 122306380 splice site probably benign
R0675:Duoxa1 UTSW 2 122306380 splice site probably benign
R0755:Duoxa1 UTSW 2 122304680 missense probably benign 0.03
R1387:Duoxa1 UTSW 2 122303987 missense possibly damaging 0.82
R2906:Duoxa1 UTSW 2 122304674 missense probably benign 0.15
R5327:Duoxa1 UTSW 2 122303880 missense probably damaging 0.98
R5886:Duoxa1 UTSW 2 122303810 missense possibly damaging 0.82
R6841:Duoxa1 UTSW 2 122303981 missense probably damaging 1.00
R6845:Duoxa1 UTSW 2 122305191 nonsense probably null
R6959:Duoxa1 UTSW 2 122303837 missense probably damaging 1.00
R7232:Duoxa1 UTSW 2 122305247 missense probably damaging 1.00
X0017:Duoxa1 UTSW 2 122304719 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCACTGACATCCTGACCTCTAG -3'
(R):5'- TGGGACATCTTCTGCCTAGGTC -3'

Sequencing Primer
(F):5'- TGACATCCTGACCTCTAGAAACAG -3'
(R):5'- CTGAAGTCCTCTCTAGCAGGTTAG -3'
Posted On2018-06-06