Incidental Mutation 'R6537:Wrap53'
ID520494
Institutional Source Beutler Lab
Gene Symbol Wrap53
Ensembl Gene ENSMUSG00000041346
Gene NameWD repeat containing, antisense to Trp53
SynonymsWdr79
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6537 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69561758-69580255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69563868 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 225 (D225G)
Ref Sequence ENSEMBL: ENSMUSP00000047825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004036] [ENSMUST00000048139]
Predicted Effect probably benign
Transcript: ENSMUST00000004036
SMART Domains Protein: ENSMUSP00000004036
Gene: ENSMUSG00000003934

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Ephrin 28 167 2.8e-45 PFAM
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000048139
AA Change: D225G

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047825
Gene: ENSMUSG00000041346
AA Change: D225G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
WD40 144 181 5.75e-1 SMART
Blast:WD40 197 242 3e-18 BLAST
WD40 245 288 1.67e-1 SMART
WD40 295 337 3.58e-1 SMART
WD40 340 380 1.19e-6 SMART
WD40 384 425 8.25e0 SMART
Blast:WD40 435 471 1e-14 BLAST
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155894
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential component of the telomerase holoenzyme complex, a ribonucleoprotein complex required for telomere synthesis. This protein is enriched in Cajal bodies, nuclear sites of RNP processing that are important for telomerase function. It interacts with dyskerin, TERT and TERC, other components of active telomerase, and with small Cajal body RNAs (scaRNAs), which are involved in modifying splicing RNAs. This mRNA also functions as a p53 antisense transcript, that regulates endogenous p53 mRNA levels and further induction of p53 protein by targeting the 5' untranslated region of p53 mRNA. Alternatively spliced transcript variants which differ only in the 5' UTR have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 T C 5: 52,843,556 S224P probably damaging Het
Col6a4 G A 9: 106,067,954 T987M possibly damaging Het
Cort C T 4: 149,126,624 G8E probably benign Het
Ctdp1 G T 18: 80,449,551 D576E probably benign Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
Cwc15 A G 9: 14,501,988 D22G probably damaging Het
Dnmt3l G A 10: 78,052,064 G136R probably null Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fxyd6 A G 9: 45,390,794 I37V possibly damaging Het
Gm10604 A C 4: 11,980,221 S28A unknown Het
Gm43302 A G 5: 105,290,995 I9T possibly damaging Het
Hmcn2 T C 2: 31,415,268 V3151A probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Kyat3 A G 3: 142,729,812 T282A probably benign Het
Lrp6 T C 6: 134,480,495 E782G probably benign Het
Lrrc3b T C 14: 15,357,946 Y220C probably damaging Het
Macf1 C T 4: 123,492,725 S1033N probably damaging Het
Mdm1 A G 10: 118,158,576 T452A probably benign Het
Nrn1l G T 8: 105,894,718 R99L probably damaging Het
Pappa T A 4: 65,297,282 I1142N probably damaging Het
Pcsk1 T C 13: 75,132,239 F728L probably damaging Het
Ptcd3 T C 6: 71,897,110 probably null Het
Siglecf C T 7: 43,355,999 T461I probably benign Het
Slc7a8 C T 14: 54,735,119 A282T probably benign Het
Srcap T C 7: 127,542,220 V1724A probably damaging Het
Tek A G 4: 94,837,324 Q609R probably benign Het
Trim45 C T 3: 100,925,396 A315V probably benign Het
Ttbk1 C T 17: 46,470,310 V446M probably damaging Het
Znhit6 A G 3: 145,594,619 I193V probably benign Het
Other mutations in Wrap53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Wrap53 APN 11 69562740 missense possibly damaging 0.72
IGL02342:Wrap53 APN 11 69563591 missense probably damaging 0.99
P4748:Wrap53 UTSW 11 69562205 missense probably damaging 1.00
R0021:Wrap53 UTSW 11 69563886 missense probably damaging 0.99
R0060:Wrap53 UTSW 11 69563430 missense possibly damaging 0.88
R0682:Wrap53 UTSW 11 69562446 missense probably damaging 1.00
R1061:Wrap53 UTSW 11 69562400 missense probably damaging 1.00
R1708:Wrap53 UTSW 11 69563935 nonsense probably null
R1868:Wrap53 UTSW 11 69562164 missense probably null 0.46
R3113:Wrap53 UTSW 11 69563318 missense probably benign 0.31
R5091:Wrap53 UTSW 11 69562447 nonsense probably null
R5119:Wrap53 UTSW 11 69563932 missense possibly damaging 0.84
R6263:Wrap53 UTSW 11 69562793 nonsense probably null
R6337:Wrap53 UTSW 11 69577685 missense probably benign 0.30
R6628:Wrap53 UTSW 11 69562144 missense probably benign 0.00
R7111:Wrap53 UTSW 11 69562479 missense probably damaging 1.00
R7138:Wrap53 UTSW 11 69563868 missense probably benign 0.32
R7431:Wrap53 UTSW 11 69578487 missense possibly damaging 0.88
X0063:Wrap53 UTSW 11 69578537 missense probably benign
Z1088:Wrap53 UTSW 11 69578498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCTGACTGTCAAAAGGG -3'
(R):5'- AGTTGCGTTCTTTGAGCCCC -3'

Sequencing Primer
(F):5'- GGAACCAAGTGCCCAGC -3'
(R):5'- GCGTGCTCTTTCCTACCTGGATAG -3'
Posted On2018-06-06