Incidental Mutation 'R6514:Mme'
ID 520495
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Name membrane metallo endopeptidase
Synonyms neprilysin, 6030454K05Rik, neutral endopeptidase, NEP, CD10
MMRRC Submission 044641-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6514 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 63202632-63291134 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 63272265 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 621 (C621*)
Ref Sequence ENSEMBL: ENSMUSP00000141544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]
AlphaFold Q61391
Predicted Effect probably null
Transcript: ENSMUST00000029400
AA Change: C621*
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: C621*

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000194134
AA Change: C621*
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: C621*

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000194150
AA Change: C621*
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: C621*

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik G A 11: 50,833,569 (GRCm39) A11V unknown Het
Add1 T A 5: 34,763,317 (GRCm39) H168Q probably damaging Het
Apol7b C T 15: 77,308,126 (GRCm39) R123Q probably benign Het
Arrdc3 A G 13: 81,037,309 (GRCm39) E155G probably damaging Het
Capn7 T G 14: 31,066,511 (GRCm39) D108E probably benign Het
Cdc6 A G 11: 98,810,118 (GRCm39) T476A probably benign Het
Cntnap5c A G 17: 58,637,165 (GRCm39) E1014G probably damaging Het
Crybg1 A T 10: 43,873,211 (GRCm39) L1299H probably damaging Het
Duoxa1 A G 2: 122,135,194 (GRCm39) S184P probably benign Het
Ech1 A G 7: 28,525,440 (GRCm39) H65R possibly damaging Het
Egr3 T C 14: 70,316,366 (GRCm39) L59P probably damaging Het
Eif4enif1 T A 11: 3,190,996 (GRCm39) D724E probably null Het
Erbb2 A G 11: 98,310,972 (GRCm39) D44G probably benign Het
Fer1l5 A G 1: 36,442,697 (GRCm39) I739V probably benign Het
Gfm1 T C 3: 67,380,879 (GRCm39) F665L probably benign Het
Gm10801 T A 2: 98,494,214 (GRCm39) W119R probably benign Het
H2-M11 A T 17: 36,859,839 (GRCm39) E277D probably damaging Het
Ighv1-66 T C 12: 115,556,740 (GRCm39) Y114C possibly damaging Het
Irf1 C G 11: 53,662,148 (GRCm39) L12V probably damaging Het
Itpr3 C T 17: 27,310,344 (GRCm39) A403V probably benign Het
Ly6g C T 15: 75,028,581 (GRCm39) P14S probably benign Het
Mfsd13a T C 19: 46,363,064 (GRCm39) probably null Het
Mmp16 T C 4: 18,116,123 (GRCm39) C576R probably damaging Het
Ngp A T 9: 110,249,017 (GRCm39) I30F probably damaging Het
Or2q1 T A 6: 42,794,930 (GRCm39) I175N probably damaging Het
Pdcd6ip G A 9: 113,518,762 (GRCm39) T166I probably benign Het
Pgd C T 4: 149,245,209 (GRCm39) probably null Het
Plcb4 T A 2: 135,796,916 (GRCm39) H440Q probably benign Het
Ppl A G 16: 4,905,181 (GRCm39) S1705P probably damaging Het
Ryr1 A G 7: 28,746,266 (GRCm39) F3831S probably damaging Het
Serpine2 A C 1: 79,799,287 (GRCm39) probably null Het
Skor2 T A 18: 76,950,389 (GRCm39) W906R probably damaging Het
Tle6 G A 10: 81,427,810 (GRCm39) H482Y probably damaging Het
Ufl1 T A 4: 25,262,238 (GRCm39) D336V probably damaging Het
Vav1 T C 17: 57,634,660 (GRCm39) F832L probably damaging Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63,247,465 (GRCm39) missense possibly damaging 0.95
IGL00329:Mme APN 3 63,287,749 (GRCm39) nonsense probably null
IGL01013:Mme APN 3 63,235,281 (GRCm39) splice site probably null
IGL01316:Mme APN 3 63,247,580 (GRCm39) splice site probably benign
IGL01333:Mme APN 3 63,253,512 (GRCm39) missense probably damaging 1.00
IGL01392:Mme APN 3 63,269,467 (GRCm39) missense probably damaging 1.00
IGL01566:Mme APN 3 63,269,350 (GRCm39) splice site probably benign
IGL01739:Mme APN 3 63,247,534 (GRCm39) missense possibly damaging 0.78
IGL01996:Mme APN 3 63,250,970 (GRCm39) missense probably benign 0.11
IGL02125:Mme APN 3 63,256,070 (GRCm39) missense probably damaging 1.00
IGL02154:Mme APN 3 63,250,976 (GRCm39) missense probably benign
IGL03214:Mme APN 3 63,237,111 (GRCm39) missense possibly damaging 0.72
IGL03291:Mme APN 3 63,253,525 (GRCm39) missense probably benign 0.00
R0498:Mme UTSW 3 63,253,487 (GRCm39) missense probably damaging 1.00
R0595:Mme UTSW 3 63,235,602 (GRCm39) missense probably benign 0.27
R0980:Mme UTSW 3 63,247,550 (GRCm39) missense probably benign
R1210:Mme UTSW 3 63,251,027 (GRCm39) missense probably benign 0.01
R1600:Mme UTSW 3 63,272,479 (GRCm39) missense probably damaging 1.00
R1852:Mme UTSW 3 63,235,467 (GRCm39) missense probably benign 0.00
R1852:Mme UTSW 3 63,235,404 (GRCm39) missense probably benign 0.31
R2037:Mme UTSW 3 63,235,681 (GRCm39) missense probably null 1.00
R2177:Mme UTSW 3 63,208,426 (GRCm39) missense probably benign 0.02
R2200:Mme UTSW 3 63,287,713 (GRCm39) missense possibly damaging 0.87
R2306:Mme UTSW 3 63,207,673 (GRCm39) missense probably benign 0.00
R2847:Mme UTSW 3 63,252,620 (GRCm39) missense possibly damaging 0.91
R3008:Mme UTSW 3 63,266,378 (GRCm39) missense probably damaging 1.00
R3749:Mme UTSW 3 63,250,961 (GRCm39) missense probably damaging 1.00
R3876:Mme UTSW 3 63,269,480 (GRCm39) splice site probably benign
R3961:Mme UTSW 3 63,252,613 (GRCm39) missense probably damaging 1.00
R3981:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R3982:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R3983:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R4494:Mme UTSW 3 63,254,613 (GRCm39) missense probably benign
R4589:Mme UTSW 3 63,287,693 (GRCm39) missense probably benign
R4706:Mme UTSW 3 63,256,133 (GRCm39) missense possibly damaging 0.92
R4871:Mme UTSW 3 63,247,453 (GRCm39) missense probably benign 0.01
R4957:Mme UTSW 3 63,250,910 (GRCm39) splice site probably benign
R5053:Mme UTSW 3 63,272,270 (GRCm39) missense probably damaging 1.00
R5316:Mme UTSW 3 63,276,375 (GRCm39) missense probably damaging 1.00
R5502:Mme UTSW 3 63,207,702 (GRCm39) nonsense probably null
R5579:Mme UTSW 3 63,256,066 (GRCm39) missense probably damaging 1.00
R6007:Mme UTSW 3 63,250,929 (GRCm39) nonsense probably null
R6022:Mme UTSW 3 63,272,218 (GRCm39) missense probably damaging 1.00
R6143:Mme UTSW 3 63,207,532 (GRCm39) splice site probably null
R6154:Mme UTSW 3 63,207,674 (GRCm39) missense probably damaging 0.98
R6333:Mme UTSW 3 63,249,382 (GRCm39) missense probably benign 0.00
R6476:Mme UTSW 3 63,251,056 (GRCm39) critical splice donor site probably null
R6711:Mme UTSW 3 63,249,339 (GRCm39) missense possibly damaging 0.93
R6842:Mme UTSW 3 63,269,465 (GRCm39) missense probably damaging 1.00
R6996:Mme UTSW 3 63,253,523 (GRCm39) missense possibly damaging 0.63
R7040:Mme UTSW 3 63,276,344 (GRCm39) missense probably damaging 1.00
R7043:Mme UTSW 3 63,252,638 (GRCm39) nonsense probably null
R7084:Mme UTSW 3 63,235,638 (GRCm39) missense probably damaging 0.98
R7126:Mme UTSW 3 63,276,322 (GRCm39) missense probably damaging 0.97
R7783:Mme UTSW 3 63,272,288 (GRCm39) missense probably damaging 1.00
R8501:Mme UTSW 3 63,234,156 (GRCm39) missense probably damaging 1.00
R8857:Mme UTSW 3 63,256,070 (GRCm39) missense probably damaging 1.00
R9453:Mme UTSW 3 63,272,306 (GRCm39) missense possibly damaging 0.90
R9556:Mme UTSW 3 63,272,225 (GRCm39) missense probably damaging 0.97
R9648:Mme UTSW 3 63,208,426 (GRCm39) missense probably benign 0.02
X0058:Mme UTSW 3 63,272,442 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCTGAAACAGTAAGTTGTACG -3'
(R):5'- GGCCAATACCTCCATTATCAGC -3'

Sequencing Primer
(F):5'- GAAACAGTAAGTTGTACGTTGTTTG -3'
(R):5'- TTATCAGCAATGTTTTCTCCTAGTG -3'
Posted On 2018-06-06