Incidental Mutation 'R6537:Slc7a8'
ID520502
Institutional Source Beutler Lab
Gene Symbol Slc7a8
Ensembl Gene ENSMUSG00000022180
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 8
SynonymsLAT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R6537 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54722209-54781946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54735119 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 282 (A282T)
Ref Sequence ENSEMBL: ENSMUSP00000022787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022787]
Predicted Effect probably benign
Transcript: ENSMUST00000022787
AA Change: A282T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022787
Gene: ENSMUSG00000022180
AA Change: A282T

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
Pfam:AA_permease_2 39 463 8.9e-72 PFAM
Pfam:AA_permease 44 469 5.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226646
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation display hypoactivity, decreased motor performance, and resistance to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 T C 5: 52,843,556 S224P probably damaging Het
Col6a4 G A 9: 106,067,954 T987M possibly damaging Het
Cort C T 4: 149,126,624 G8E probably benign Het
Ctdp1 G T 18: 80,449,551 D576E probably benign Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
Cwc15 A G 9: 14,501,988 D22G probably damaging Het
Dnmt3l G A 10: 78,052,064 G136R probably null Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fxyd6 A G 9: 45,390,794 I37V possibly damaging Het
Gm10604 A C 4: 11,980,221 S28A unknown Het
Gm43302 A G 5: 105,290,995 I9T possibly damaging Het
Hmcn2 T C 2: 31,415,268 V3151A probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Kyat3 A G 3: 142,729,812 T282A probably benign Het
Lrp6 T C 6: 134,480,495 E782G probably benign Het
Lrrc3b T C 14: 15,357,946 Y220C probably damaging Het
Macf1 C T 4: 123,492,725 S1033N probably damaging Het
Mdm1 A G 10: 118,158,576 T452A probably benign Het
Nrn1l G T 8: 105,894,718 R99L probably damaging Het
Pappa T A 4: 65,297,282 I1142N probably damaging Het
Pcsk1 T C 13: 75,132,239 F728L probably damaging Het
Ptcd3 T C 6: 71,897,110 probably null Het
Siglecf C T 7: 43,355,999 T461I probably benign Het
Srcap T C 7: 127,542,220 V1724A probably damaging Het
Tek A G 4: 94,837,324 Q609R probably benign Het
Trim45 C T 3: 100,925,396 A315V probably benign Het
Ttbk1 C T 17: 46,470,310 V446M probably damaging Het
Wrap53 T C 11: 69,563,868 D225G possibly damaging Het
Znhit6 A G 3: 145,594,619 I193V probably benign Het
Other mutations in Slc7a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Slc7a8 APN 14 54735124 missense probably benign 0.25
IGL01366:Slc7a8 APN 14 54781188 missense probably damaging 1.00
R0582:Slc7a8 UTSW 14 54758444 missense probably damaging 1.00
R0724:Slc7a8 UTSW 14 54735186 splice site probably benign
R1122:Slc7a8 UTSW 14 54724107 missense probably benign
R1468:Slc7a8 UTSW 14 54733199 missense probably damaging 1.00
R1468:Slc7a8 UTSW 14 54733199 missense probably damaging 1.00
R1667:Slc7a8 UTSW 14 54724849 missense probably damaging 1.00
R2878:Slc7a8 UTSW 14 54759686 missense probably damaging 1.00
R3826:Slc7a8 UTSW 14 54737572 missense probably damaging 1.00
R3938:Slc7a8 UTSW 14 54735841 missense probably benign 0.01
R4513:Slc7a8 UTSW 14 54735790 missense possibly damaging 0.94
R4514:Slc7a8 UTSW 14 54735790 missense possibly damaging 0.94
R4524:Slc7a8 UTSW 14 54737602 missense probably damaging 1.00
R4544:Slc7a8 UTSW 14 54735790 missense possibly damaging 0.94
R4546:Slc7a8 UTSW 14 54735790 missense possibly damaging 0.94
R5179:Slc7a8 UTSW 14 54724832 nonsense probably null
R5395:Slc7a8 UTSW 14 54733277 nonsense probably null
R6144:Slc7a8 UTSW 14 54729340 missense probably damaging 1.00
R7337:Slc7a8 UTSW 14 54726806 missense possibly damaging 0.67
R7404:Slc7a8 UTSW 14 54726826 missense probably damaging 1.00
R7597:Slc7a8 UTSW 14 54781400 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CACCACTAGTTTGCTCCTGG -3'
(R):5'- TGAGTCAGAACCTACCTCCC -3'

Sequencing Primer
(F):5'- TCCTGGGCACTTGGAAGATAC -3'
(R):5'- TGAGTCAGAACCTACCTCCCAAATAG -3'
Posted On2018-06-06