Incidental Mutation 'R6537:Ctdp1'
ID520506
Institutional Source Beutler Lab
Gene Symbol Ctdp1
Ensembl Gene ENSMUSG00000033323
Gene NameCTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Synonyms4930563P03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R6537 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80407959-80469695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80449551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 576 (D576E)
Ref Sequence ENSEMBL: ENSMUSP00000038938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036229]
Predicted Effect probably benign
Transcript: ENSMUST00000036229
AA Change: D576E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: D576E

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 T C 5: 52,843,556 S224P probably damaging Het
Col6a4 G A 9: 106,067,954 T987M possibly damaging Het
Cort C T 4: 149,126,624 G8E probably benign Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
Cwc15 A G 9: 14,501,988 D22G probably damaging Het
Dnmt3l G A 10: 78,052,064 G136R probably null Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fxyd6 A G 9: 45,390,794 I37V possibly damaging Het
Gm10604 A C 4: 11,980,221 S28A unknown Het
Gm43302 A G 5: 105,290,995 I9T possibly damaging Het
Hmcn2 T C 2: 31,415,268 V3151A probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Kyat3 A G 3: 142,729,812 T282A probably benign Het
Lrp6 T C 6: 134,480,495 E782G probably benign Het
Lrrc3b T C 14: 15,357,946 Y220C probably damaging Het
Macf1 C T 4: 123,492,725 S1033N probably damaging Het
Mdm1 A G 10: 118,158,576 T452A probably benign Het
Nrn1l G T 8: 105,894,718 R99L probably damaging Het
Pappa T A 4: 65,297,282 I1142N probably damaging Het
Pcsk1 T C 13: 75,132,239 F728L probably damaging Het
Ptcd3 T C 6: 71,897,110 probably null Het
Siglecf C T 7: 43,355,999 T461I probably benign Het
Slc7a8 C T 14: 54,735,119 A282T probably benign Het
Srcap T C 7: 127,542,220 V1724A probably damaging Het
Tek A G 4: 94,837,324 Q609R probably benign Het
Trim45 C T 3: 100,925,396 A315V probably benign Het
Ttbk1 C T 17: 46,470,310 V446M probably damaging Het
Wrap53 T C 11: 69,563,868 D225G possibly damaging Het
Znhit6 A G 3: 145,594,619 I193V probably benign Het
Other mutations in Ctdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Ctdp1 APN 18 80458692 splice site probably null
IGL01695:Ctdp1 APN 18 80449626 missense probably damaging 1.00
IGL01865:Ctdp1 APN 18 80455984 missense probably damaging 1.00
IGL02009:Ctdp1 APN 18 80455972 missense probably damaging 1.00
IGL02419:Ctdp1 APN 18 80420584 missense probably damaging 1.00
IGL02580:Ctdp1 APN 18 80450090 missense probably benign 0.01
IGL02699:Ctdp1 APN 18 80450185 missense probably benign
IGL03117:Ctdp1 APN 18 80449501 missense probably damaging 0.98
IGL03301:Ctdp1 APN 18 80449634 nonsense probably null
IGL03385:Ctdp1 APN 18 80449918 missense probably damaging 1.00
R0370:Ctdp1 UTSW 18 80449354 missense probably damaging 1.00
R0374:Ctdp1 UTSW 18 80447422 critical splice donor site probably null
R0730:Ctdp1 UTSW 18 80450242 missense probably benign 0.00
R0894:Ctdp1 UTSW 18 80469521 missense probably benign 0.09
R1187:Ctdp1 UTSW 18 80449487 missense probably damaging 1.00
R1437:Ctdp1 UTSW 18 80450213 missense probably benign 0.01
R1988:Ctdp1 UTSW 18 80449401 missense possibly damaging 0.89
R2192:Ctdp1 UTSW 18 80449481 missense probably benign 0.30
R3709:Ctdp1 UTSW 18 80450213 nonsense probably null
R3724:Ctdp1 UTSW 18 80459267 missense probably benign 0.16
R3756:Ctdp1 UTSW 18 80452351 missense probably damaging 0.98
R4297:Ctdp1 UTSW 18 80449957 missense probably benign
R4298:Ctdp1 UTSW 18 80449957 missense probably benign
R4640:Ctdp1 UTSW 18 80451154 critical splice donor site probably null
R4841:Ctdp1 UTSW 18 80408726 missense unknown
R4842:Ctdp1 UTSW 18 80408726 missense unknown
R5007:Ctdp1 UTSW 18 80420480 missense probably damaging 0.99
R5055:Ctdp1 UTSW 18 80456088 missense probably damaging 1.00
R5219:Ctdp1 UTSW 18 80447460 missense probably damaging 1.00
R5870:Ctdp1 UTSW 18 80408686 missense unknown
R5896:Ctdp1 UTSW 18 80458788 missense probably damaging 1.00
R6242:Ctdp1 UTSW 18 80459212 missense probably damaging 1.00
R6255:Ctdp1 UTSW 18 80459297 critical splice acceptor site probably null
R6300:Ctdp1 UTSW 18 80459240 missense probably benign 0.26
R6431:Ctdp1 UTSW 18 80451255 missense probably damaging 0.96
R6462:Ctdp1 UTSW 18 80420474 missense probably damaging 0.98
R6512:Ctdp1 UTSW 18 80451263 missense probably damaging 1.00
R6802:Ctdp1 UTSW 18 80420441 critical splice donor site probably null
X0020:Ctdp1 UTSW 18 80449990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATAGTGCTCGCGAGTCTTTTC -3'
(R):5'- AAAGGGTCAGACCTGGACAC -3'

Sequencing Primer
(F):5'- CGCGAGTCTTTTCCACAGG -3'
(R):5'- CTCAGGAGGAGGGTGAACG -3'
Posted On2018-06-06