Mutagenetix > Incidental Mutation

Incidental Mutation 'R6514:Ryr1'

520511

Institutional Source

Beutler Lab

Gene Symbol

Ryr1

Ensembl Gene

ENSMUSG00000030592

Gene Name

ryanodine receptor 1, skeletal muscle

Synonyms

calcium release channel isoform 1, Ryr, skrr

MMRRC Submission

044641-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6514 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

28702765-28824599 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28746266 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 3831 (F3831S)

Ref Sequence

ENSEMBL: ENSMUSP00000137123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000032813
AA Change: F3829S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: F3829S

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	441	645	1.2e-73	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	851	945	6.5e-33	PFAM
Pfam:RyR	965	1059	1.5e-30	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2158	2366	7e-66	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2735	2829	9.7e-34	PFAM
Pfam:RyR	2855	2943	5.7e-32	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3613	3642	2e-13	PDB
low complexity region	3681	3691	N/A	INTRINSIC
low complexity region	3735	3760	N/A	INTRINSIC
Pfam:RIH_assoc	3872	4004	1.9e-41	PFAM
low complexity region	4010	4023	N/A	INTRINSIC
Pfam:EF-hand_8	4085	4136	9.8e-8	PFAM
transmembrane domain	4283	4305	N/A	INTRINSIC
transmembrane domain	4318	4336	N/A	INTRINSIC
transmembrane domain	4341	4363	N/A	INTRINSIC
Pfam:RR_TM4-6	4377	4666	2e-86	PFAM
Pfam:Ion_trans	4761	4932	3.4e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000179893
AA Change: F3831S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: F3831S

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	443	638	4.5e-63	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	852	942	1.3e-37	PFAM
Pfam:RyR	966	1056	1.6e-28	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2160	2366	2.2e-68	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2736	2826	7.2e-31	PFAM
Pfam:RyR	2856	2940	5.6e-27	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3615	3644	2e-13	PDB
low complexity region	3683	3693	N/A	INTRINSIC
low complexity region	3737	3762	N/A	INTRINSIC
Pfam:RIH_assoc	3878	3996	6.2e-35	PFAM
low complexity region	4012	4025	N/A	INTRINSIC
Pfam:EF-hand_8	4087	4137	1.8e-8	PFAM
transmembrane domain	4285	4307	N/A	INTRINSIC
transmembrane domain	4320	4338	N/A	INTRINSIC
transmembrane domain	4343	4365	N/A	INTRINSIC
Pfam:RR_TM4-6	4379	4668	8.4e-76	PFAM
Pfam:Ion_trans	4763	4946	2.8e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208318

Predicted Effect

probably damaging
Transcript: ENSMUST00000214374
AA Change: F3838S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.2%

Validation Efficiency

95% (35/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933414I15Rik	G	A	11: 50,833,569 (GRCm39)	A11V	unknown	Het
Add1	T	A	5: 34,763,317 (GRCm39)	H168Q	probably damaging	Het
Apol7b	C	T	15: 77,308,126 (GRCm39)	R123Q	probably benign	Het
Arrdc3	A	G	13: 81,037,309 (GRCm39)	E155G	probably damaging	Het
Capn7	T	G	14: 31,066,511 (GRCm39)	D108E	probably benign	Het
Cdc6	A	G	11: 98,810,118 (GRCm39)	T476A	probably benign	Het
Cntnap5c	A	G	17: 58,637,165 (GRCm39)	E1014G	probably damaging	Het
Crybg1	A	T	10: 43,873,211 (GRCm39)	L1299H	probably damaging	Het
Duoxa1	A	G	2: 122,135,194 (GRCm39)	S184P	probably benign	Het
Ech1	A	G	7: 28,525,440 (GRCm39)	H65R	possibly damaging	Het
Egr3	T	C	14: 70,316,366 (GRCm39)	L59P	probably damaging	Het
Eif4enif1	T	A	11: 3,190,996 (GRCm39)	D724E	probably null	Het
Erbb2	A	G	11: 98,310,972 (GRCm39)	D44G	probably benign	Het
Fer1l5	A	G	1: 36,442,697 (GRCm39)	I739V	probably benign	Het
Gfm1	T	C	3: 67,380,879 (GRCm39)	F665L	probably benign	Het
Gm10801	T	A	2: 98,494,214 (GRCm39)	W119R	probably benign	Het
H2-M11	A	T	17: 36,859,839 (GRCm39)	E277D	probably damaging	Het
Ighv1-66	T	C	12: 115,556,740 (GRCm39)	Y114C	possibly damaging	Het
Irf1	C	G	11: 53,662,148 (GRCm39)	L12V	probably damaging	Het
Itpr3	C	T	17: 27,310,344 (GRCm39)	A403V	probably benign	Het
Ly6g	C	T	15: 75,028,581 (GRCm39)	P14S	probably benign	Het
Mfsd13a	T	C	19: 46,363,064 (GRCm39)		probably null	Het
Mme	T	A	3: 63,272,265 (GRCm39)	C621*	probably null	Het
Mmp16	T	C	4: 18,116,123 (GRCm39)	C576R	probably damaging	Het
Ngp	A	T	9: 110,249,017 (GRCm39)	I30F	probably damaging	Het
Or2q1	T	A	6: 42,794,930 (GRCm39)	I175N	probably damaging	Het
Pdcd6ip	G	A	9: 113,518,762 (GRCm39)	T166I	probably benign	Het
Pgd	C	T	4: 149,245,209 (GRCm39)		probably null	Het
Plcb4	T	A	2: 135,796,916 (GRCm39)	H440Q	probably benign	Het
Ppl	A	G	16: 4,905,181 (GRCm39)	S1705P	probably damaging	Het
Serpine2	A	C	1: 79,799,287 (GRCm39)		probably null	Het
Skor2	T	A	18: 76,950,389 (GRCm39)	W906R	probably damaging	Het
Tle6	G	A	10: 81,427,810 (GRCm39)	H482Y	probably damaging	Het
Ufl1	T	A	4: 25,262,238 (GRCm39)	D336V	probably damaging	Het
Vav1	T	C	17: 57,634,660 (GRCm39)	F832L	probably damaging	Het

Other mutations in Ryr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ryr1	APN	7	28,802,235 (GRCm39)	missense	probably damaging	1.00
IGL00335:Ryr1	APN	7	28,824,385 (GRCm39)	splice site	probably null
IGL00427:Ryr1	APN	7	28,804,162 (GRCm39)	splice site	probably benign
IGL00559:Ryr1	APN	7	28,711,667 (GRCm39)	splice site	probably benign
IGL00803:Ryr1	APN	7	28,769,070 (GRCm39)	missense	possibly damaging	0.95
IGL00886:Ryr1	APN	7	28,723,654 (GRCm39)	missense	probably damaging	1.00
IGL00948:Ryr1	APN	7	28,719,620 (GRCm39)	missense	possibly damaging	0.78
IGL01017:Ryr1	APN	7	28,781,968 (GRCm39)	missense	probably damaging	0.99
IGL01116:Ryr1	APN	7	28,799,627 (GRCm39)	splice site	probably benign
IGL01385:Ryr1	APN	7	28,756,410 (GRCm39)	missense	probably damaging	1.00
IGL01482:Ryr1	APN	7	28,751,762 (GRCm39)	missense	probably damaging	1.00
IGL01529:Ryr1	APN	7	28,774,652 (GRCm39)	missense	probably damaging	1.00
IGL01543:Ryr1	APN	7	28,790,501 (GRCm39)	missense	probably damaging	1.00
IGL01653:Ryr1	APN	7	28,778,022 (GRCm39)	missense	probably damaging	0.99
IGL01701:Ryr1	APN	7	28,759,235 (GRCm39)	missense	probably damaging	0.98
IGL02051:Ryr1	APN	7	28,771,083 (GRCm39)	missense	probably benign	0.16
IGL02152:Ryr1	APN	7	28,751,440 (GRCm39)	missense	possibly damaging	0.95
IGL02271:Ryr1	APN	7	28,793,472 (GRCm39)	missense	probably benign	0.07
IGL02321:Ryr1	APN	7	28,778,121 (GRCm39)	missense	probably damaging	1.00
IGL02448:Ryr1	APN	7	28,804,491 (GRCm39)	splice site	probably benign
IGL02472:Ryr1	APN	7	28,740,269 (GRCm39)	missense	probably damaging	1.00
IGL02544:Ryr1	APN	7	28,815,024 (GRCm39)	missense	probably benign	0.24
IGL02666:Ryr1	APN	7	28,719,188 (GRCm39)	missense	unknown
IGL02672:Ryr1	APN	7	28,703,944 (GRCm39)	unclassified	probably benign
IGL02677:Ryr1	APN	7	28,810,033 (GRCm39)	missense	probably benign	0.18
IGL02686:Ryr1	APN	7	28,768,975 (GRCm39)	splice site	probably benign
IGL02751:Ryr1	APN	7	28,778,199 (GRCm39)	missense	probably damaging	1.00
IGL02899:Ryr1	APN	7	28,748,220 (GRCm39)	missense	possibly damaging	0.53
IGL02926:Ryr1	APN	7	28,760,965 (GRCm39)	missense	probably damaging	1.00
IGL02950:Ryr1	APN	7	28,796,884 (GRCm39)	missense	probably damaging	1.00
IGL02960:Ryr1	APN	7	28,759,478 (GRCm39)	missense	probably damaging	1.00
IGL02968:Ryr1	APN	7	28,743,318 (GRCm39)	missense	probably damaging	1.00
IGL03070:Ryr1	APN	7	28,770,084 (GRCm39)	missense	probably damaging	1.00
IGL03091:Ryr1	APN	7	28,782,911 (GRCm39)	missense	possibly damaging	0.85
IGL03100:Ryr1	APN	7	28,804,018 (GRCm39)	missense	probably damaging	1.00
IGL03107:Ryr1	APN	7	28,774,624 (GRCm39)	missense	probably damaging	1.00
IGL03117:Ryr1	APN	7	28,802,389 (GRCm39)	missense	probably damaging	1.00
IGL03118:Ryr1	APN	7	28,715,211 (GRCm39)	missense	unknown
IGL03146:Ryr1	APN	7	28,793,457 (GRCm39)	missense	probably benign	0.09
IGL03165:Ryr1	APN	7	28,804,465 (GRCm39)	missense	probably benign	0.22
IGL03220:Ryr1	APN	7	28,759,280 (GRCm39)	missense	probably damaging	1.00
R0017:Ryr1	UTSW	7	28,746,967 (GRCm39)	missense	probably damaging	1.00
R0066:Ryr1	UTSW	7	28,704,992 (GRCm39)	unclassified	probably benign
R0066:Ryr1	UTSW	7	28,704,992 (GRCm39)	unclassified	probably benign
R0069:Ryr1	UTSW	7	28,809,930 (GRCm39)	splice site	probably benign
R0148:Ryr1	UTSW	7	28,751,460 (GRCm39)	missense	probably damaging	0.99
R0266:Ryr1	UTSW	7	28,740,104 (GRCm39)	missense	probably damaging	1.00
R0346:Ryr1	UTSW	7	28,767,013 (GRCm39)	splice site	probably benign
R0387:Ryr1	UTSW	7	28,782,792 (GRCm39)	splice site	probably benign
R0454:Ryr1	UTSW	7	28,735,500 (GRCm39)	missense	probably damaging	0.99
R0494:Ryr1	UTSW	7	28,703,218 (GRCm39)	splice site	probably benign
R0533:Ryr1	UTSW	7	28,778,205 (GRCm39)	missense	probably damaging	1.00
R0585:Ryr1	UTSW	7	28,735,501 (GRCm39)	missense	probably damaging	1.00
R0591:Ryr1	UTSW	7	28,804,220 (GRCm39)	missense	possibly damaging	0.68
R0624:Ryr1	UTSW	7	28,774,034 (GRCm39)	missense	probably damaging	1.00
R0662:Ryr1	UTSW	7	28,799,614 (GRCm39)	missense	probably damaging	1.00
R0849:Ryr1	UTSW	7	28,740,104 (GRCm39)	missense	probably damaging	1.00
R0961:Ryr1	UTSW	7	28,709,122 (GRCm39)	missense	unknown
R1052:Ryr1	UTSW	7	28,795,683 (GRCm39)	missense	probably damaging	0.96
R1218:Ryr1	UTSW	7	28,785,534 (GRCm39)	missense	possibly damaging	0.79
R1340:Ryr1	UTSW	7	28,815,437 (GRCm39)	missense	probably damaging	0.99
R1513:Ryr1	UTSW	7	28,770,046 (GRCm39)	missense	probably damaging	1.00
R1543:Ryr1	UTSW	7	28,782,962 (GRCm39)	missense	possibly damaging	0.67
R1566:Ryr1	UTSW	7	28,791,600 (GRCm39)	missense	possibly damaging	0.95
R1572:Ryr1	UTSW	7	28,761,616 (GRCm39)	missense	probably damaging	1.00
R1623:Ryr1	UTSW	7	28,794,915 (GRCm39)	missense	probably damaging	1.00
R1632:Ryr1	UTSW	7	28,793,686 (GRCm39)	missense	probably benign	0.03
R1661:Ryr1	UTSW	7	28,801,163 (GRCm39)	missense	probably damaging	0.98
R1665:Ryr1	UTSW	7	28,735,503 (GRCm39)	missense	probably damaging	1.00
R1678:Ryr1	UTSW	7	28,815,579 (GRCm39)	missense	probably damaging	0.99
R1705:Ryr1	UTSW	7	28,777,989 (GRCm39)	missense	probably damaging	1.00
R1712:Ryr1	UTSW	7	28,746,928 (GRCm39)	missense	probably benign	0.25
R1720:Ryr1	UTSW	7	28,801,295 (GRCm39)	missense	probably damaging	0.99
R1799:Ryr1	UTSW	7	28,767,046 (GRCm39)	missense	probably damaging	1.00
R1847:Ryr1	UTSW	7	28,779,236 (GRCm39)	missense	probably benign	0.43
R1860:Ryr1	UTSW	7	28,708,977 (GRCm39)	missense	unknown
R1861:Ryr1	UTSW	7	28,708,977 (GRCm39)	missense	unknown
R1921:Ryr1	UTSW	7	28,754,369 (GRCm39)	missense	probably damaging	1.00
R1983:Ryr1	UTSW	7	28,758,897 (GRCm39)	missense	possibly damaging	0.74
R2043:Ryr1	UTSW	7	28,759,056 (GRCm39)	missense	probably damaging	0.99
R2089:Ryr1	UTSW	7	28,785,474 (GRCm39)	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	28,785,474 (GRCm39)	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	28,785,474 (GRCm39)	missense	probably damaging	1.00
R2105:Ryr1	UTSW	7	28,789,575 (GRCm39)	missense	probably damaging	0.99
R2175:Ryr1	UTSW	7	28,767,867 (GRCm39)	missense	probably damaging	1.00
R2259:Ryr1	UTSW	7	28,719,166 (GRCm39)	missense	unknown
R2291:Ryr1	UTSW	7	28,798,202 (GRCm39)	missense	probably damaging	1.00
R2351:Ryr1	UTSW	7	28,774,718 (GRCm39)	missense	probably benign	0.18
R2512:Ryr1	UTSW	7	28,802,967 (GRCm39)	missense	possibly damaging	0.64
R2571:Ryr1	UTSW	7	28,735,551 (GRCm39)	missense	possibly damaging	0.94
R2571:Ryr1	UTSW	7	28,708,987 (GRCm39)	missense	unknown
R2885:Ryr1	UTSW	7	28,774,223 (GRCm39)	missense	probably damaging	0.99
R2886:Ryr1	UTSW	7	28,774,223 (GRCm39)	missense	probably damaging	0.99
R2889:Ryr1	UTSW	7	28,778,166 (GRCm39)	missense	possibly damaging	0.76
R3051:Ryr1	UTSW	7	28,752,515 (GRCm39)	missense	probably damaging	1.00
R3052:Ryr1	UTSW	7	28,752,515 (GRCm39)	missense	probably damaging	1.00
R3053:Ryr1	UTSW	7	28,752,515 (GRCm39)	missense	probably damaging	1.00
R3082:Ryr1	UTSW	7	28,745,071 (GRCm39)	missense	probably damaging	1.00
R3103:Ryr1	UTSW	7	28,774,373 (GRCm39)	missense	probably damaging	1.00
R3237:Ryr1	UTSW	7	28,769,075 (GRCm39)	critical splice acceptor site	probably null
R3551:Ryr1	UTSW	7	28,756,422 (GRCm39)	missense	probably damaging	1.00
R3552:Ryr1	UTSW	7	28,756,422 (GRCm39)	missense	probably damaging	1.00
R3807:Ryr1	UTSW	7	28,719,577 (GRCm39)	missense	probably damaging	1.00
R3815:Ryr1	UTSW	7	28,772,327 (GRCm39)	missense	probably damaging	0.98
R4010:Ryr1	UTSW	7	28,794,549 (GRCm39)	missense	probably benign	0.41
R4041:Ryr1	UTSW	7	28,785,356 (GRCm39)	missense	possibly damaging	0.77
R4226:Ryr1	UTSW	7	28,761,576 (GRCm39)	nonsense	probably null
R4257:Ryr1	UTSW	7	28,781,875 (GRCm39)	missense	possibly damaging	0.93
R4328:Ryr1	UTSW	7	28,782,484 (GRCm39)	missense	probably damaging	1.00
R4394:Ryr1	UTSW	7	28,793,667 (GRCm39)	missense	possibly damaging	0.69
R4485:Ryr1	UTSW	7	28,789,581 (GRCm39)	missense	probably damaging	0.97
R4550:Ryr1	UTSW	7	28,798,160 (GRCm39)	missense	probably benign	0.05
R4554:Ryr1	UTSW	7	28,804,433 (GRCm39)	missense	probably benign	0.03
R4562:Ryr1	UTSW	7	28,774,005 (GRCm39)	intron	probably benign
R4642:Ryr1	UTSW	7	28,785,463 (GRCm39)	missense	possibly damaging	0.91
R4669:Ryr1	UTSW	7	28,759,256 (GRCm39)	missense	probably null	0.99
R4707:Ryr1	UTSW	7	28,745,087 (GRCm39)	missense	probably damaging	1.00
R4766:Ryr1	UTSW	7	28,785,258 (GRCm39)	missense	probably damaging	0.96
R4768:Ryr1	UTSW	7	28,704,246 (GRCm39)	unclassified	probably benign
R4770:Ryr1	UTSW	7	28,808,707 (GRCm39)	missense	probably damaging	0.99
R4780:Ryr1	UTSW	7	28,794,522 (GRCm39)	missense	possibly damaging	0.85
R4927:Ryr1	UTSW	7	28,719,408 (GRCm39)	missense	unknown
R4933:Ryr1	UTSW	7	28,803,723 (GRCm39)	missense	probably damaging	1.00
R4934:Ryr1	UTSW	7	28,767,520 (GRCm39)	missense	probably damaging	1.00
R4942:Ryr1	UTSW	7	28,768,998 (GRCm39)	missense	probably damaging	0.98
R4960:Ryr1	UTSW	7	28,778,208 (GRCm39)	missense	possibly damaging	0.82
R5007:Ryr1	UTSW	7	28,768,540 (GRCm39)	missense	probably damaging	1.00
R5011:Ryr1	UTSW	7	28,802,234 (GRCm39)	splice site	probably null
R5013:Ryr1	UTSW	7	28,802,234 (GRCm39)	splice site	probably null
R5137:Ryr1	UTSW	7	28,801,283 (GRCm39)	missense	possibly damaging	0.94
R5167:Ryr1	UTSW	7	28,767,118 (GRCm39)	missense	probably damaging	1.00
R5239:Ryr1	UTSW	7	28,735,553 (GRCm39)	missense	probably damaging	1.00
R5291:Ryr1	UTSW	7	28,815,023 (GRCm39)	missense	probably benign	0.03
R5303:Ryr1	UTSW	7	28,767,907 (GRCm39)	missense	probably damaging	1.00
R5386:Ryr1	UTSW	7	28,816,841 (GRCm39)	missense	probably damaging	0.98
R5431:Ryr1	UTSW	7	28,809,237 (GRCm39)	missense	probably benign	0.39
R5460:Ryr1	UTSW	7	28,771,386 (GRCm39)	missense	probably damaging	1.00
R5463:Ryr1	UTSW	7	28,723,448 (GRCm39)	missense	possibly damaging	0.79
R5503:Ryr1	UTSW	7	28,768,453 (GRCm39)	missense	possibly damaging	0.87
R5541:Ryr1	UTSW	7	28,785,610 (GRCm39)	missense	probably damaging	1.00
R5573:Ryr1	UTSW	7	28,715,148 (GRCm39)	missense	unknown
R5575:Ryr1	UTSW	7	28,778,118 (GRCm39)	missense	possibly damaging	0.77
R5610:Ryr1	UTSW	7	28,811,399 (GRCm39)	missense	probably benign	0.05
R5658:Ryr1	UTSW	7	28,790,514 (GRCm39)	splice site	probably null
R5918:Ryr1	UTSW	7	28,708,577 (GRCm39)	missense	probably benign	0.39
R5926:Ryr1	UTSW	7	28,803,785 (GRCm39)	missense	probably damaging	1.00
R5938:Ryr1	UTSW	7	28,746,290 (GRCm39)	missense	probably damaging	1.00
R5939:Ryr1	UTSW	7	28,815,552 (GRCm39)	missense	probably damaging	0.97
R5947:Ryr1	UTSW	7	28,771,349 (GRCm39)	missense	probably null	0.98
R5991:Ryr1	UTSW	7	28,804,035 (GRCm39)	missense	probably damaging	0.99
R5992:Ryr1	UTSW	7	28,767,062 (GRCm39)	missense	probably damaging	1.00
R5996:Ryr1	UTSW	7	28,723,666 (GRCm39)	missense	probably benign	0.38
R6075:Ryr1	UTSW	7	28,786,863 (GRCm39)	missense	probably damaging	1.00
R6091:Ryr1	UTSW	7	28,771,398 (GRCm39)	missense	probably benign	0.01
R6126:Ryr1	UTSW	7	28,775,664 (GRCm39)	missense	probably null	1.00
R6147:Ryr1	UTSW	7	28,785,339 (GRCm39)	missense	possibly damaging	0.88
R6235:Ryr1	UTSW	7	28,815,606 (GRCm39)	missense	probably benign	0.07
R6279:Ryr1	UTSW	7	28,786,853 (GRCm39)	missense	possibly damaging	0.93
R6381:Ryr1	UTSW	7	28,774,682 (GRCm39)	missense	possibly damaging	0.87
R6441:Ryr1	UTSW	7	28,759,120 (GRCm39)	missense	possibly damaging	0.95
R6443:Ryr1	UTSW	7	28,776,503 (GRCm39)	missense	probably damaging	0.97
R6459:Ryr1	UTSW	7	28,715,079 (GRCm39)	missense	probably benign	0.39
R6563:Ryr1	UTSW	7	28,794,917 (GRCm39)	missense	possibly damaging	0.92
R6660:Ryr1	UTSW	7	28,737,770 (GRCm39)	critical splice donor site	probably null
R6746:Ryr1	UTSW	7	28,816,829 (GRCm39)	missense	possibly damaging	0.56
R6785:Ryr1	UTSW	7	28,764,299 (GRCm39)	missense	probably benign	0.12
R6800:Ryr1	UTSW	7	28,723,741 (GRCm39)	missense	possibly damaging	0.95
R6939:Ryr1	UTSW	7	28,751,751 (GRCm39)	missense	possibly damaging	0.91
R6980:Ryr1	UTSW	7	28,808,812 (GRCm39)	missense	probably benign	0.03
R6995:Ryr1	UTSW	7	28,793,607 (GRCm39)	missense	probably damaging	0.97
R7065:Ryr1	UTSW	7	28,803,068 (GRCm39)	missense	probably damaging	1.00
R7123:Ryr1	UTSW	7	28,746,279 (GRCm39)	missense	probably benign	0.37
R7238:Ryr1	UTSW	7	28,794,807 (GRCm39)	missense	probably benign	0.24
R7240:Ryr1	UTSW	7	28,751,440 (GRCm39)	missense	possibly damaging	0.95
R7300:Ryr1	UTSW	7	28,758,936 (GRCm39)	missense	probably damaging	1.00
R7365:Ryr1	UTSW	7	28,785,180 (GRCm39)	missense	probably benign	0.05
R7403:Ryr1	UTSW	7	28,713,292 (GRCm39)	missense	probably benign	0.34
R7422:Ryr1	UTSW	7	28,785,295 (GRCm39)	missense	probably benign	0.00
R7493:Ryr1	UTSW	7	28,794,630 (GRCm39)	missense	probably benign	0.44
R7570:Ryr1	UTSW	7	28,778,010 (GRCm39)	missense	probably damaging	0.98
R7593:Ryr1	UTSW	7	28,735,528 (GRCm39)	missense	probably damaging	1.00
R7769:Ryr1	UTSW	7	28,798,210 (GRCm39)	missense	probably damaging	1.00
R7781:Ryr1	UTSW	7	28,767,055 (GRCm39)	missense	probably damaging	1.00
R7790:Ryr1	UTSW	7	28,804,257 (GRCm39)	missense	probably benign	0.39
R7799:Ryr1	UTSW	7	28,702,985 (GRCm39)	splice site	probably null
R7916:Ryr1	UTSW	7	28,790,364 (GRCm39)	nonsense	probably null
R7922:Ryr1	UTSW	7	28,796,649 (GRCm39)	missense	probably benign	0.09
R7988:Ryr1	UTSW	7	28,795,596 (GRCm39)	missense	probably benign	0.29
R7997:Ryr1	UTSW	7	28,702,968 (GRCm39)	missense	unknown
R8052:Ryr1	UTSW	7	28,782,810 (GRCm39)	missense	probably benign	0.05
R8096:Ryr1	UTSW	7	28,708,626 (GRCm39)	missense	unknown
R8116:Ryr1	UTSW	7	28,810,308 (GRCm39)	missense	probably benign	0.03
R8202:Ryr1	UTSW	7	28,790,457 (GRCm39)	missense	probably benign	0.18
R8207:Ryr1	UTSW	7	28,789,650 (GRCm39)	missense	probably damaging	1.00
R8248:Ryr1	UTSW	7	28,768,546 (GRCm39)	missense	probably damaging	1.00
R8257:Ryr1	UTSW	7	28,764,064 (GRCm39)	missense	possibly damaging	0.82
R8354:Ryr1	UTSW	7	28,715,142 (GRCm39)	missense	unknown
R8454:Ryr1	UTSW	7	28,715,142 (GRCm39)	missense	unknown
R8487:Ryr1	UTSW	7	28,740,292 (GRCm39)	missense	probably damaging	0.97
R8529:Ryr1	UTSW	7	28,769,509 (GRCm39)	missense	possibly damaging	0.86
R8545:Ryr1	UTSW	7	28,704,239 (GRCm39)	unclassified	probably benign
R8678:Ryr1	UTSW	7	28,776,489 (GRCm39)	missense	probably damaging	0.99
R8717:Ryr1	UTSW	7	28,751,753 (GRCm39)	missense	probably benign	0.03
R8724:Ryr1	UTSW	7	28,816,802 (GRCm39)	missense	probably benign	0.04
R8755:Ryr1	UTSW	7	28,791,693 (GRCm39)	missense	probably benign	0.19
R8772:Ryr1	UTSW	7	28,815,557 (GRCm39)	missense	probably benign	0.05
R8790:Ryr1	UTSW	7	28,776,297 (GRCm39)	missense	probably damaging	1.00
R8793:Ryr1	UTSW	7	28,764,284 (GRCm39)	missense	probably damaging	1.00
R8836:Ryr1	UTSW	7	28,774,091 (GRCm39)	missense	probably damaging	1.00
R8858:Ryr1	UTSW	7	28,808,638 (GRCm39)	missense	probably benign	0.00
R8910:Ryr1	UTSW	7	28,771,340 (GRCm39)	missense	probably damaging	1.00
R8920:Ryr1	UTSW	7	28,789,640 (GRCm39)	missense	possibly damaging	0.89
R8938:Ryr1	UTSW	7	28,801,358 (GRCm39)	missense	probably damaging	1.00
R9035:Ryr1	UTSW	7	28,790,422 (GRCm39)	missense	probably damaging	0.97
R9115:Ryr1	UTSW	7	28,803,989 (GRCm39)	nonsense	probably null
R9123:Ryr1	UTSW	7	28,771,229 (GRCm39)	missense	probably damaging	1.00
R9154:Ryr1	UTSW	7	28,769,283 (GRCm39)	missense	probably benign	0.08
R9189:Ryr1	UTSW	7	28,776,471 (GRCm39)	missense	probably damaging	1.00
R9200:Ryr1	UTSW	7	28,794,524 (GRCm39)	missense	probably benign	0.00
R9214:Ryr1	UTSW	7	28,785,187 (GRCm39)	missense	possibly damaging	0.52
R9216:Ryr1	UTSW	7	28,801,277 (GRCm39)	missense	probably damaging	0.97
R9240:Ryr1	UTSW	7	28,743,313 (GRCm39)	missense	probably damaging	1.00
R9261:Ryr1	UTSW	7	28,751,813 (GRCm39)	missense	possibly damaging	0.91
R9276:Ryr1	UTSW	7	28,802,254 (GRCm39)	missense	probably damaging	0.99
R9280:Ryr1	UTSW	7	28,802,389 (GRCm39)	missense	probably damaging	1.00
R9316:Ryr1	UTSW	7	28,717,387 (GRCm39)	missense	unknown
R9333:Ryr1	UTSW	7	28,774,214 (GRCm39)	critical splice donor site	probably null
R9459:Ryr1	UTSW	7	28,768,068 (GRCm39)	missense	probably damaging	1.00
R9468:Ryr1	UTSW	7	28,772,510 (GRCm39)	missense	probably damaging	1.00
R9486:Ryr1	UTSW	7	28,777,965 (GRCm39)	missense	probably benign	0.15
R9524:Ryr1	UTSW	7	28,723,600 (GRCm39)	missense	probably damaging	1.00
R9620:Ryr1	UTSW	7	28,715,138 (GRCm39)	missense	unknown
R9664:Ryr1	UTSW	7	28,759,092 (GRCm39)	missense	probably damaging	1.00
R9776:Ryr1	UTSW	7	28,774,664 (GRCm39)	missense	probably damaging	1.00
X0021:Ryr1	UTSW	7	28,760,956 (GRCm39)	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	28,802,923 (GRCm39)	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	28,785,460 (GRCm39)	missense	probably benign	0.10
Z1176:Ryr1	UTSW	7	28,719,639 (GRCm39)	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	28,801,347 (GRCm39)	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	28,748,217 (GRCm39)	nonsense	probably null
Z1177:Ryr1	UTSW	7	28,717,410 (GRCm39)	missense	unknown
Z1186:Ryr1	UTSW	7	28,781,902 (GRCm39)	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- TGAGATTCTTCCTAGTAAACGCTC -3'
(R):5'- CTGGGTATCTCCATCCTTAACGG -3'

Sequencing Primer
(F):5'- GTAAACGCTCTAGTATTTGTACTCC -3'
(R):5'- TCCTTAACGGAGGGAACGCTG -3'

Posted On

2018-06-06