Incidental Mutation 'R6514:Ngp'
ID520513
Institutional Source Beutler Lab
Gene Symbol Ngp
Ensembl Gene ENSMUSG00000032484
Gene Nameneutrophilic granule protein
Synonymsmyeloid granule protein, bectenecin, clone B6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6514 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110419747-110423012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110419949 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 30 (I30F)
Ref Sequence ENSEMBL: ENSMUSP00000035061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035061]
Predicted Effect probably damaging
Transcript: ENSMUST00000035061
AA Change: I30F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035061
Gene: ENSMUSG00000032484
AA Change: I30F

DomainStartEndE-ValueType
CY 10 116 7.92e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 95% (35/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik G A 11: 50,942,742 A11V unknown Het
Add1 T A 5: 34,605,973 H168Q probably damaging Het
Apol7b C T 15: 77,423,926 R123Q probably benign Het
Arrdc3 A G 13: 80,889,190 E155G probably damaging Het
Capn7 T G 14: 31,344,554 D108E probably benign Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cntnap5c A G 17: 58,330,170 E1014G probably damaging Het
Crybg1 A T 10: 43,997,215 L1299H probably damaging Het
Duoxa1 A G 2: 122,304,713 S184P probably benign Het
Ech1 A G 7: 28,826,015 H65R possibly damaging Het
Egr3 T C 14: 70,078,917 L59P probably damaging Het
Eif4enif1 T A 11: 3,240,996 D724E probably null Het
Erbb2 A G 11: 98,420,146 D44G probably benign Het
Fer1l5 A G 1: 36,403,616 I739V probably benign Het
Gfm1 T C 3: 67,473,546 F665L probably benign Het
Gm10801 T A 2: 98,663,869 W119R probably benign Het
H2-M11 A T 17: 36,548,947 E277D probably damaging Het
Ighv1-66 T C 12: 115,593,120 Y114C possibly damaging Het
Irf1 C G 11: 53,771,322 L12V probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Ly6g C T 15: 75,156,732 P14S probably benign Het
Mfsd13a T C 19: 46,374,625 probably null Het
Mme T A 3: 63,364,844 C621* probably null Het
Mmp16 T C 4: 18,116,123 C576R probably damaging Het
Olfr450 T A 6: 42,817,996 I175N probably damaging Het
Pdcd6ip G A 9: 113,689,694 T166I probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Plcb4 T A 2: 135,954,996 H440Q probably benign Het
Ppl A G 16: 5,087,317 S1705P probably damaging Het
Ryr1 A G 7: 29,046,841 F3831S probably damaging Het
Serpine2 A C 1: 79,821,570 probably null Het
Skor2 T A 18: 76,862,694 W906R probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Ufl1 T A 4: 25,262,238 D336V probably damaging Het
Vav1 T C 17: 57,327,660 F832L probably damaging Het
Other mutations in Ngp
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Ngp UTSW 9 110422269 unclassified probably benign
R0230:Ngp UTSW 9 110420001 missense probably damaging 1.00
R2004:Ngp UTSW 9 110420861 missense probably damaging 1.00
R4610:Ngp UTSW 9 110420815 missense possibly damaging 0.92
R5100:Ngp UTSW 9 110420001 missense probably damaging 1.00
R5762:Ngp UTSW 9 110422333 missense probably benign 0.09
R6791:Ngp UTSW 9 110419949 missense probably benign 0.01
R7286:Ngp UTSW 9 110420910 missense probably benign 0.00
R7500:Ngp UTSW 9 110419765 utr 5 prime probably null
R7820:Ngp UTSW 9 110420864 missense probably benign 0.04
RF021:Ngp UTSW 9 110421756 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTATGTCACCGGCAGTTCTTG -3'
(R):5'- TTCATGTCTCATGCCAGGAG -3'

Sequencing Primer
(F):5'- CTTGGGCAAGGCAGTCTCAATATC -3'
(R):5'- GGCTGGCCTAGAATTCATTACCTAG -3'
Posted On2018-06-06