Incidental Mutation 'R6514:Pdcd6ip'
ID520515
Institutional Source Beutler Lab
Gene Symbol Pdcd6ip
Ensembl Gene ENSMUSG00000032504
Gene Nameprogrammed cell death 6 interacting protein
SynonymsAlix, AIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6514 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location113651744-113708259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113689694 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 166 (T166I)
Ref Sequence ENSEMBL: ENSMUSP00000107492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]
Predicted Effect probably benign
Transcript: ENSMUST00000035086
AA Change: T166I

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504
AA Change: T166I

DomainStartEndE-ValueType
BRO1 3 382 1.99e-160 SMART
Pfam:ALIX_LYPXL_bnd 408 702 3.6e-91 PFAM
low complexity region 731 812 N/A INTRINSIC
Blast:BRO1 813 839 2e-11 BLAST
low complexity region 840 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111861
AA Change: T166I

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504
AA Change: T166I

DomainStartEndE-ValueType
BRO1 3 387 3.46e-160 SMART
Pfam:ALIX_LYPXL_bnd 417 706 8.8e-96 PFAM
low complexity region 736 817 N/A INTRINSIC
Blast:BRO1 818 844 2e-11 BLAST
low complexity region 845 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156425
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik G A 11: 50,942,742 A11V unknown Het
Add1 T A 5: 34,605,973 H168Q probably damaging Het
Apol7b C T 15: 77,423,926 R123Q probably benign Het
Arrdc3 A G 13: 80,889,190 E155G probably damaging Het
Capn7 T G 14: 31,344,554 D108E probably benign Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cntnap5c A G 17: 58,330,170 E1014G probably damaging Het
Crybg1 A T 10: 43,997,215 L1299H probably damaging Het
Duoxa1 A G 2: 122,304,713 S184P probably benign Het
Ech1 A G 7: 28,826,015 H65R possibly damaging Het
Egr3 T C 14: 70,078,917 L59P probably damaging Het
Eif4enif1 T A 11: 3,240,996 D724E probably null Het
Erbb2 A G 11: 98,420,146 D44G probably benign Het
Fer1l5 A G 1: 36,403,616 I739V probably benign Het
Gfm1 T C 3: 67,473,546 F665L probably benign Het
Gm10801 T A 2: 98,663,869 W119R probably benign Het
H2-M11 A T 17: 36,548,947 E277D probably damaging Het
Ighv1-66 T C 12: 115,593,120 Y114C possibly damaging Het
Irf1 C G 11: 53,771,322 L12V probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Ly6g C T 15: 75,156,732 P14S probably benign Het
Mfsd13a T C 19: 46,374,625 probably null Het
Mme T A 3: 63,364,844 C621* probably null Het
Mmp16 T C 4: 18,116,123 C576R probably damaging Het
Ngp A T 9: 110,419,949 I30F probably damaging Het
Olfr450 T A 6: 42,817,996 I175N probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plcb4 T A 2: 135,954,996 H440Q probably benign Het
Ppl A G 16: 5,087,317 S1705P probably damaging Het
Ryr1 A G 7: 29,046,841 F3831S probably damaging Het
Serpine2 A C 1: 79,821,570 probably null Het
Skor2 T A 18: 76,862,694 W906R probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Ufl1 T A 4: 25,262,238 D336V probably damaging Het
Vav1 T C 17: 57,327,660 F832L probably damaging Het
Other mutations in Pdcd6ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pdcd6ip APN 9 113697518 missense possibly damaging 0.89
IGL00814:Pdcd6ip APN 9 113687653 missense probably damaging 0.97
IGL01092:Pdcd6ip APN 9 113680181 splice site probably benign
IGL01621:Pdcd6ip APN 9 113685422 missense probably benign 0.03
IGL01781:Pdcd6ip APN 9 113691498 missense probably damaging 1.00
IGL02158:Pdcd6ip APN 9 113680053 nonsense probably null
IGL03136:Pdcd6ip APN 9 113691499 missense probably damaging 1.00
IGL03137:Pdcd6ip APN 9 113657145 missense possibly damaging 0.69
IGL03246:Pdcd6ip APN 9 113678417 missense possibly damaging 0.93
R0230:Pdcd6ip UTSW 9 113685293 splice site probably benign
R0284:Pdcd6ip UTSW 9 113662504 missense probably damaging 1.00
R0862:Pdcd6ip UTSW 9 113674510 splice site probably benign
R0864:Pdcd6ip UTSW 9 113674510 splice site probably benign
R1025:Pdcd6ip UTSW 9 113662286 missense probably damaging 1.00
R1687:Pdcd6ip UTSW 9 113700019 missense probably damaging 1.00
R1699:Pdcd6ip UTSW 9 113678354 missense probably damaging 1.00
R1957:Pdcd6ip UTSW 9 113708022 missense probably damaging 1.00
R2317:Pdcd6ip UTSW 9 113672774 missense probably benign 0.03
R2698:Pdcd6ip UTSW 9 113674507 splice site probably null
R4182:Pdcd6ip UTSW 9 113700010 missense probably benign 0.00
R5154:Pdcd6ip UTSW 9 113691542 missense probably damaging 1.00
R5229:Pdcd6ip UTSW 9 113678333 missense probably damaging 0.99
R5391:Pdcd6ip UTSW 9 113691518 missense probably damaging 1.00
R5972:Pdcd6ip UTSW 9 113662298 missense probably benign 0.07
R6149:Pdcd6ip UTSW 9 113659871 missense probably benign 0.03
R6406:Pdcd6ip UTSW 9 113674344 missense possibly damaging 0.81
R6869:Pdcd6ip UTSW 9 113655106 missense unknown
R6888:Pdcd6ip UTSW 9 113671837 missense probably benign 0.04
R7078:Pdcd6ip UTSW 9 113659885 missense probably benign 0.01
R7683:Pdcd6ip UTSW 9 113687695 missense probably damaging 1.00
R8260:Pdcd6ip UTSW 9 113672797 missense probably benign 0.05
R8376:Pdcd6ip UTSW 9 113689616 missense probably damaging 1.00
Z1177:Pdcd6ip UTSW 9 113685369 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTACCCTACCTACCTGGACTACTG -3'
(R):5'- AGGCCCATCTATGAATTGGGATG -3'

Sequencing Primer
(F):5'- CTCTTGGTATAAAAGCCTAGCACTCG -3'
(R):5'- CCCATCTATGAATTGGGATGTACGG -3'
Posted On2018-06-06