Incidental Mutation 'R6514:Erbb2'
ID520526
Institutional Source Beutler Lab
Gene Symbol Erbb2
Ensembl Gene ENSMUSG00000062312
Gene Nameerb-b2 receptor tyrosine kinase 2
Synonymsc-erbB2, c-neu, HER-2, HER2, Neu, ErbB-2, Neu oncogene
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6514 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98412470-98437716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98420146 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 44 (D44G)
Ref Sequence ENSEMBL: ENSMUSP00000053897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058295]
Predicted Effect probably benign
Transcript: ENSMUST00000058295
AA Change: D44G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000053897
Gene: ENSMUSG00000062312
AA Change: D44G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Recep_L_domain 52 174 2e-32 PFAM
FU 190 231 1.88e1 SMART
FU 233 276 1.03e-6 SMART
Pfam:Recep_L_domain 367 487 2.3e-23 PFAM
FU 502 551 3.08e-5 SMART
FU 558 607 3.97e-8 SMART
transmembrane domain 654 676 N/A INTRINSIC
TyrKc 721 977 1.28e-126 SMART
low complexity region 1040 1080 N/A INTRINSIC
low complexity region 1148 1163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158598
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit degeneration of motor nerves, an absence of Schwann cells, impairment of junctional folds at the neuromuscular synapse, and cardiac defects that results in lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik G A 11: 50,942,742 A11V unknown Het
Add1 T A 5: 34,605,973 H168Q probably damaging Het
Apol7b C T 15: 77,423,926 R123Q probably benign Het
Arrdc3 A G 13: 80,889,190 E155G probably damaging Het
Capn7 T G 14: 31,344,554 D108E probably benign Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cntnap5c A G 17: 58,330,170 E1014G probably damaging Het
Crybg1 A T 10: 43,997,215 L1299H probably damaging Het
Duoxa1 A G 2: 122,304,713 S184P probably benign Het
Ech1 A G 7: 28,826,015 H65R possibly damaging Het
Egr3 T C 14: 70,078,917 L59P probably damaging Het
Eif4enif1 T A 11: 3,240,996 D724E probably null Het
Fer1l5 A G 1: 36,403,616 I739V probably benign Het
Gfm1 T C 3: 67,473,546 F665L probably benign Het
Gm10801 T A 2: 98,663,869 W119R probably benign Het
H2-M11 A T 17: 36,548,947 E277D probably damaging Het
Ighv1-66 T C 12: 115,593,120 Y114C possibly damaging Het
Irf1 C G 11: 53,771,322 L12V probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Ly6g C T 15: 75,156,732 P14S probably benign Het
Mfsd13a T C 19: 46,374,625 probably null Het
Mme T A 3: 63,364,844 C621* probably null Het
Mmp16 T C 4: 18,116,123 C576R probably damaging Het
Ngp A T 9: 110,419,949 I30F probably damaging Het
Olfr450 T A 6: 42,817,996 I175N probably damaging Het
Pdcd6ip G A 9: 113,689,694 T166I probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Plcb4 T A 2: 135,954,996 H440Q probably benign Het
Ppl A G 16: 5,087,317 S1705P probably damaging Het
Ryr1 A G 7: 29,046,841 F3831S probably damaging Het
Serpine2 A C 1: 79,821,570 probably null Het
Skor2 T A 18: 76,862,694 W906R probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Ufl1 T A 4: 25,262,238 D336V probably damaging Het
Vav1 T C 17: 57,327,660 F832L probably damaging Het
Other mutations in Erbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Erbb2 APN 11 98435630 missense probably damaging 1.00
IGL01460:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01483:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01514:Erbb2 APN 11 98432919 missense possibly damaging 0.94
IGL01520:Erbb2 APN 11 98434009 missense probably benign 0.05
IGL03007:Erbb2 APN 11 98428993 splice site probably benign
IGL03367:Erbb2 APN 11 98422875 splice site probably null
Angular UTSW 11 98422770 missense probably damaging 0.98
PIT4544001:Erbb2 UTSW 11 98421039 missense probably benign
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0388:Erbb2 UTSW 11 98427351 missense possibly damaging 0.66
R0602:Erbb2 UTSW 11 98434271 missense probably damaging 1.00
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1500:Erbb2 UTSW 11 98428978 missense probably damaging 1.00
R1651:Erbb2 UTSW 11 98433457 missense probably damaging 1.00
R1748:Erbb2 UTSW 11 98435335 missense probably benign 0.06
R1807:Erbb2 UTSW 11 98428854 missense probably damaging 1.00
R1861:Erbb2 UTSW 11 98412737 critical splice donor site probably null
R1926:Erbb2 UTSW 11 98425164 missense probably benign
R1998:Erbb2 UTSW 11 98428953 missense probably damaging 1.00
R2051:Erbb2 UTSW 11 98420172 missense probably damaging 1.00
R3147:Erbb2 UTSW 11 98434039 missense probably damaging 1.00
R4022:Erbb2 UTSW 11 98435297 missense probably benign 0.09
R4238:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4239:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4240:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4633:Erbb2 UTSW 11 98432988 missense possibly damaging 0.91
R4725:Erbb2 UTSW 11 98425144 missense possibly damaging 0.71
R5093:Erbb2 UTSW 11 98427453 missense probably damaging 1.00
R5306:Erbb2 UTSW 11 98428206 missense probably benign 0.44
R5375:Erbb2 UTSW 11 98433412 missense probably damaging 1.00
R5518:Erbb2 UTSW 11 98422770 missense probably damaging 0.98
R5710:Erbb2 UTSW 11 98427080 missense probably damaging 1.00
R5938:Erbb2 UTSW 11 98435571 missense probably damaging 0.99
R6062:Erbb2 UTSW 11 98433249 missense probably damaging 1.00
R6116:Erbb2 UTSW 11 98427399 missense probably damaging 1.00
R6556:Erbb2 UTSW 11 98436082 missense possibly damaging 0.92
R6570:Erbb2 UTSW 11 98423047 missense possibly damaging 0.88
R6578:Erbb2 UTSW 11 98428188 missense probably damaging 1.00
R7141:Erbb2 UTSW 11 98427309 missense probably damaging 1.00
R7686:Erbb2 UTSW 11 98435573 missense probably benign
R8274:Erbb2 UTSW 11 98433896 missense probably damaging 1.00
R8439:Erbb2 UTSW 11 98428972 missense possibly damaging 0.89
X0028:Erbb2 UTSW 11 98434301 missense probably damaging 1.00
X0062:Erbb2 UTSW 11 98423120 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTACTCTAGGCCCTGTGGATG -3'
(R):5'- CCTGATTGAGGAACCACAAGAG -3'

Sequencing Primer
(F):5'- TAGGCCCTGTGGATGCAGAG -3'
(R):5'- GAGCGAATACAGGAATGTAGTTGCC -3'
Posted On2018-06-06