Incidental Mutation 'R6538:Zfp715'
ID520535
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Namezinc finger protein 715
Synonymsmszf15, 2610041B18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6538 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43296197-43313294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43299149 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 462 (H462Q)
Ref Sequence ENSEMBL: ENSMUSP00000103620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
Predicted Effect probably benign
Transcript: ENSMUST00000012796
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000048015
AA Change: H462Q

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: H462Q

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107986
AA Change: H462Q

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: H462Q

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135130
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139061
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151659
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A G 10: 115,570,199 probably benign Het
Abcd4 T A 12: 84,611,761 M223L probably benign Het
Adat1 T C 8: 111,968,462 I482V probably benign Het
Arfgef2 A G 2: 166,893,621 probably null Het
Atn1 A G 6: 124,746,549 probably benign Het
Cyb561d2 C A 9: 107,540,017 M178I possibly damaging Het
Dnah14 A T 1: 181,584,985 H30L unknown Het
Dnah2 T C 11: 69,437,197 I3367V possibly damaging Het
Fcmr A G 1: 130,875,025 Y125C possibly damaging Het
Gm21731 T C 13: 120,240,932 V88A possibly damaging Het
Gm7298 G T 6: 121,776,173 V870L probably damaging Het
Gm9774 C T 3: 92,429,255 V47M possibly damaging Het
Grin3a T C 4: 49,770,856 S639G probably damaging Het
Hist1h1t A G 13: 23,695,921 E19G probably benign Het
Ighv9-1 T A 12: 114,094,065 T72S possibly damaging Het
Klra2 T A 6: 131,242,990 H76L probably damaging Het
Lamp1 A G 8: 13,171,285 T209A probably benign Het
Lrrc9 T A 12: 72,500,929 Y1294N probably benign Het
Olfr1094 A T 2: 86,829,525 T258S possibly damaging Het
Olfr222 C T 11: 59,571,585 V52I probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pik3ca T C 3: 32,439,704 Y272H probably damaging Het
Spindoc T C 19: 7,382,699 I35V probably benign Het
St6galnac4 A C 2: 32,597,078 M262L possibly damaging Het
Szt2 C T 4: 118,390,477 probably null Het
Trem1 T C 17: 48,237,090 Y48H possibly damaging Het
Trim38 A T 13: 23,785,949 T164S probably damaging Het
Zfyve16 C T 13: 92,504,516 G1240E probably damaging Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1943:Zfp715 UTSW 7 43299630 missense possibly damaging 0.86
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2073:Zfp715 UTSW 7 43311120 missense probably benign 0.01
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R2403:Zfp715 UTSW 7 43299268 missense possibly damaging 0.91
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4426:Zfp715 UTSW 7 43311092 missense probably damaging 0.99
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5007:Zfp715 UTSW 7 43299595 missense possibly damaging 0.53
R5477:Zfp715 UTSW 7 43299954 missense probably damaging 0.99
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R7322:Zfp715 UTSW 7 43311138 missense possibly damaging 0.53
R7629:Zfp715 UTSW 7 43301676 missense possibly damaging 0.92
R7934:Zfp715 UTSW 7 43299884 nonsense probably null
R7973:Zfp715 UTSW 7 43299897 missense possibly damaging 0.64
R8327:Zfp715 UTSW 7 43298058 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CAGTCATTGCATTTGTAAGGCTTC -3'
(R):5'- TGGGTCAGCTTTCTATGAACATG -3'

Sequencing Primer
(F):5'- ATTTGTAAGGCTTCTCCCCAGGG -3'
(R):5'- GGTCAGCTTTCTATGAACATGAATTG -3'
Posted On2018-06-06