Incidental Mutation 'R6538:Lamp1'
ID520537
Institutional Source Beutler Lab
Gene Symbol Lamp1
Ensembl Gene ENSMUSG00000031447
Gene Namelysosomal-associated membrane protein 1
SynonymsLamp-1, CD107a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6538 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location13159161-13175338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13171285 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 209 (T209A)
Ref Sequence ENSEMBL: ENSMUSP00000033824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033824] [ENSMUST00000209895] [ENSMUST00000210317]
Predicted Effect probably benign
Transcript: ENSMUST00000033824
AA Change: T209A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033824
Gene: ENSMUSG00000031447
AA Change: T209A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Lamp 106 406 4.8e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209709
Predicted Effect probably benign
Transcript: ENSMUST00000209895
Predicted Effect probably benign
Transcript: ENSMUST00000210317
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may also play a role in tumor cell metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A G 10: 115,570,199 probably benign Het
Abcd4 T A 12: 84,611,761 M223L probably benign Het
Adat1 T C 8: 111,968,462 I482V probably benign Het
Arfgef2 A G 2: 166,893,621 probably null Het
Atn1 A G 6: 124,746,549 probably benign Het
Cyb561d2 C A 9: 107,540,017 M178I possibly damaging Het
Dnah14 A T 1: 181,584,985 H30L unknown Het
Dnah2 T C 11: 69,437,197 I3367V possibly damaging Het
Fcmr A G 1: 130,875,025 Y125C possibly damaging Het
Gm21731 T C 13: 120,240,932 V88A possibly damaging Het
Gm7298 G T 6: 121,776,173 V870L probably damaging Het
Gm9774 C T 3: 92,429,255 V47M possibly damaging Het
Grin3a T C 4: 49,770,856 S639G probably damaging Het
Hist1h1t A G 13: 23,695,921 E19G probably benign Het
Ighv9-1 T A 12: 114,094,065 T72S possibly damaging Het
Klra2 T A 6: 131,242,990 H76L probably damaging Het
Lrrc9 T A 12: 72,500,929 Y1294N probably benign Het
Olfr1094 A T 2: 86,829,525 T258S possibly damaging Het
Olfr222 C T 11: 59,571,585 V52I probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pik3ca T C 3: 32,439,704 Y272H probably damaging Het
Spindoc T C 19: 7,382,699 I35V probably benign Het
St6galnac4 A C 2: 32,597,078 M262L possibly damaging Het
Szt2 C T 4: 118,390,477 probably null Het
Trem1 T C 17: 48,237,090 Y48H possibly damaging Het
Trim38 A T 13: 23,785,949 T164S probably damaging Het
Zfp715 A T 7: 43,299,149 H462Q possibly damaging Het
Zfyve16 C T 13: 92,504,516 G1240E probably damaging Het
Other mutations in Lamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Lamp1 APN 8 13171195 unclassified probably benign
IGL01516:Lamp1 APN 8 13173863 missense probably damaging 0.98
IGL01541:Lamp1 APN 8 13165905 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0127:Lamp1 UTSW 8 13174491 missense probably damaging 1.00
R0744:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R0836:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R1875:Lamp1 UTSW 8 13167257 missense probably damaging 1.00
R1945:Lamp1 UTSW 8 13172545 missense probably benign 0.40
R2887:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2888:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2889:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2890:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R4235:Lamp1 UTSW 8 13167192 missense possibly damaging 0.66
R4817:Lamp1 UTSW 8 13172541 missense probably benign 0.43
R5654:Lamp1 UTSW 8 13171388 splice site probably null
R5942:Lamp1 UTSW 8 13173941 missense probably damaging 1.00
R6917:Lamp1 UTSW 8 13172563 missense probably damaging 1.00
R6977:Lamp1 UTSW 8 13173661 missense probably damaging 0.98
R7262:Lamp1 UTSW 8 13167296 missense probably benign 0.01
R7680:Lamp1 UTSW 8 13167812 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGTTCAGAAGTGGGTGTC -3'
(R):5'- ATGTAGCCCAGGACTCAGAG -3'

Sequencing Primer
(F):5'- GGGTGTCTCTAGTTCTAACATGCAC -3'
(R):5'- CCTGCACAACTGATACAGTATATAC -3'
Posted On2018-06-06