Incidental Mutation 'R6538:Cyb561d2'
ID520541
Institutional Source Beutler Lab
Gene Symbol Cyb561d2
Ensembl Gene ENSMUSG00000037190
Gene Namecytochrome b-561 domain containing 2
SynonymsTsp10, 101F6 protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6538 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107539007-107542193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107540017 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 178 (M178I)
Ref Sequence ENSEMBL: ENSMUSP00000141723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010189] [ENSMUST00000010201] [ENSMUST00000041459] [ENSMUST00000194967] [ENSMUST00000195235] [ENSMUST00000195370]
Predicted Effect probably benign
Transcript: ENSMUST00000010189
SMART Domains Protein: ENSMUSP00000010189
Gene: ENSMUSG00000010045

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
DUF1751 49 151 4.14e-41 SMART
transmembrane domain 164 183 N/A INTRINSIC
transmembrane domain 190 208 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Blast:DUF1751 304 347 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000010201
SMART Domains Protein: ENSMUSP00000010201
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 5 279 1.7e-75 PFAM
Pfam:NPR2 269 373 1.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000041459
AA Change: M178I

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044093
Gene: ENSMUSG00000037190
AA Change: M178I

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193628
Predicted Effect probably benign
Transcript: ENSMUST00000194344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194906
Predicted Effect probably benign
Transcript: ENSMUST00000194967
Predicted Effect possibly damaging
Transcript: ENSMUST00000195235
AA Change: M178I

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141723
Gene: ENSMUSG00000037190
AA Change: M178I

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195370
SMART Domains Protein: ENSMUSP00000141746
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 2 156 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A G 10: 115,570,199 probably benign Het
Abcd4 T A 12: 84,611,761 M223L probably benign Het
Adat1 T C 8: 111,968,462 I482V probably benign Het
Arfgef2 A G 2: 166,893,621 probably null Het
Atn1 A G 6: 124,746,549 probably benign Het
Dnah14 A T 1: 181,584,985 H30L unknown Het
Dnah2 T C 11: 69,437,197 I3367V possibly damaging Het
Fcmr A G 1: 130,875,025 Y125C possibly damaging Het
Gm21731 T C 13: 120,240,932 V88A possibly damaging Het
Gm7298 G T 6: 121,776,173 V870L probably damaging Het
Gm9774 C T 3: 92,429,255 V47M possibly damaging Het
Grin3a T C 4: 49,770,856 S639G probably damaging Het
Hist1h1t A G 13: 23,695,921 E19G probably benign Het
Ighv9-1 T A 12: 114,094,065 T72S possibly damaging Het
Klra2 T A 6: 131,242,990 H76L probably damaging Het
Lamp1 A G 8: 13,171,285 T209A probably benign Het
Lrrc9 T A 12: 72,500,929 Y1294N probably benign Het
Olfr1094 A T 2: 86,829,525 T258S possibly damaging Het
Olfr222 C T 11: 59,571,585 V52I probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pik3ca T C 3: 32,439,704 Y272H probably damaging Het
Spindoc T C 19: 7,382,699 I35V probably benign Het
St6galnac4 A C 2: 32,597,078 M262L possibly damaging Het
Szt2 C T 4: 118,390,477 probably null Het
Trem1 T C 17: 48,237,090 Y48H possibly damaging Het
Trim38 A T 13: 23,785,949 T164S probably damaging Het
Zfp715 A T 7: 43,299,149 H462Q possibly damaging Het
Zfyve16 C T 13: 92,504,516 G1240E probably damaging Het
Other mutations in Cyb561d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Cyb561d2 APN 9 107540289 critical splice donor site probably null
IGL01890:Cyb561d2 APN 9 107541523 missense probably damaging 0.98
IGL02668:Cyb561d2 APN 9 107540172 missense probably benign 0.00
R1434:Cyb561d2 UTSW 9 107541643 unclassified probably benign
R1937:Cyb561d2 UTSW 9 107540316 missense probably damaging 1.00
R3416:Cyb561d2 UTSW 9 107540126 missense probably damaging 1.00
R4995:Cyb561d2 UTSW 9 107541548 missense probably damaging 1.00
R7564:Cyb561d2 UTSW 9 107541019 missense probably benign 0.02
R7719:Cyb561d2 UTSW 9 107540184 missense probably benign
R8117:Cyb561d2 UTSW 9 107541572 missense probably benign 0.43
Z1176:Cyb561d2 UTSW 9 107540296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGTGCAAATCCAGCCTTC -3'
(R):5'- TGTCATCCTCCACAAAGAGCAG -3'

Sequencing Primer
(F):5'- CCAGCCTTCGTAATAACTGGTGAG -3'
(R):5'- TCCACAAAGAGCAGCTTGG -3'
Posted On2018-06-06