Incidental Mutation 'R6514:Vav1'
ID520551
Institutional Source Beutler Lab
Gene Symbol Vav1
Ensembl Gene ENSMUSG00000034116
Gene Namevav 1 oncogene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R6514 (G1)
Quality Score204.009
Status Validated
Chromosome17
Chromosomal Location57279100-57328031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57327660 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 832 (F832L)
Ref Sequence ENSEMBL: ENSMUSP00000005889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]
PDB Structure
NMR STRUCTURE OF THE Y174 AUTOINHIBITED DBL HOMOLOGY DOMAIN [SOLUTION NMR]
CRYSTAL STRUCTURE OF VAV SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF VAV AND GRB2 SH3 DOMAINS [X-RAY DIFFRACTION]
Solution structure of N-terminal SH3 domain mutant(P33G) of murine Vav [SOLUTION NMR]
Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method [SOLUTION NMR]
CRITICAL STRUCTURAL ROLE FOR THE PH AND C1 DOMAINS OF THE VAV1 EXCHANGE FACTOR [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005889
AA Change: F832L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: F832L

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000008847
Predicted Effect probably damaging
Transcript: ENSMUST00000112870
AA Change: F793L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: F793L

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169220
AA Change: F808L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: F808L

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Meta Mutation Damage Score 0.6251 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik G A 11: 50,942,742 A11V unknown Het
Add1 T A 5: 34,605,973 H168Q probably damaging Het
Apol7b C T 15: 77,423,926 R123Q probably benign Het
Arrdc3 A G 13: 80,889,190 E155G probably damaging Het
Capn7 T G 14: 31,344,554 D108E probably benign Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cntnap5c A G 17: 58,330,170 E1014G probably damaging Het
Crybg1 A T 10: 43,997,215 L1299H probably damaging Het
Duoxa1 A G 2: 122,304,713 S184P probably benign Het
Ech1 A G 7: 28,826,015 H65R possibly damaging Het
Egr3 T C 14: 70,078,917 L59P probably damaging Het
Eif4enif1 T A 11: 3,240,996 D724E probably null Het
Erbb2 A G 11: 98,420,146 D44G probably benign Het
Fer1l5 A G 1: 36,403,616 I739V probably benign Het
Gfm1 T C 3: 67,473,546 F665L probably benign Het
Gm10801 T A 2: 98,663,869 W119R probably benign Het
H2-M11 A T 17: 36,548,947 E277D probably damaging Het
Ighv1-66 T C 12: 115,593,120 Y114C possibly damaging Het
Irf1 C G 11: 53,771,322 L12V probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Ly6g C T 15: 75,156,732 P14S probably benign Het
Mfsd13a T C 19: 46,374,625 probably null Het
Mme T A 3: 63,364,844 C621* probably null Het
Mmp16 T C 4: 18,116,123 C576R probably damaging Het
Ngp A T 9: 110,419,949 I30F probably damaging Het
Olfr450 T A 6: 42,817,996 I175N probably damaging Het
Pdcd6ip G A 9: 113,689,694 T166I probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Plcb4 T A 2: 135,954,996 H440Q probably benign Het
Ppl A G 16: 5,087,317 S1705P probably damaging Het
Ryr1 A G 7: 29,046,841 F3831S probably damaging Het
Serpine2 A C 1: 79,821,570 probably null Het
Skor2 T A 18: 76,862,694 W906R probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Ufl1 T A 4: 25,262,238 D336V probably damaging Het
Other mutations in Vav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Belated UTSW 17 57301214 missense probably benign 0.06
Delayed UTSW 17 57296552 missense probably damaging 1.00
finally UTSW 17 57311860 nonsense probably null
Last UTSW 17 57296039 missense probably damaging 0.99
Late UTSW 17 57301870 missense possibly damaging 0.91
Plain_sight UTSW 17 57297122 missense probably damaging 1.00
tardive UTSW 17 57303079 nonsense probably null
R0116:Vav1 UTSW 17 57296039 missense probably damaging 0.99
R0125:Vav1 UTSW 17 57299847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57299839 splice site probably null
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57303079 nonsense probably null
R5592:Vav1 UTSW 17 57304835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57279268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57311860 nonsense probably null
R7322:Vav1 UTSW 17 57302266 missense probably benign
R7335:Vav1 UTSW 17 57296720 missense probably benign
R7474:Vav1 UTSW 17 57299102 missense probably benign 0.07
R7665:Vav1 UTSW 17 57297086 missense probably damaging 1.00
Z1176:Vav1 UTSW 17 57303853 missense probably damaging 1.00
Z1177:Vav1 UTSW 17 57303040 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CACTGACGAGGTGACACATG -3'
(R):5'- AAATTACGCATCTCTGGGCTTTATC -3'

Sequencing Primer
(F):5'- GTGACACATGAGCATAGACTTTTAGG -3'
(R):5'- ATCTCTGGGCTTTATCCTGGGAAC -3'
Posted On2018-06-06