Incidental Mutation 'R6515:Ap1s3'
ID520561
Institutional Source Beutler Lab
Gene Symbol Ap1s3
Ensembl Gene ENSMUSG00000054702
Gene Nameadaptor-related protein complex AP-1, sigma 3
Synonyms[s]3A, Jr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R6515 (G1)
Quality Score184.009
Status Validated
Chromosome1
Chromosomal Location79606876-79671972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79614327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000125268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159312] [ENSMUST00000160706] [ENSMUST00000162342]
Predicted Effect probably benign
Transcript: ENSMUST00000159312
SMART Domains Protein: ENSMUSP00000125119
Gene: ENSMUSG00000054702

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 70 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160706
AA Change: I66V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125631
Gene: ENSMUSG00000054702
AA Change: I66V

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 81 1.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162342
AA Change: D102G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125268
Gene: ENSMUSG00000054702
AA Change: D102G

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5e-60 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor-related protein complex 1, sigma subunit genes. The encoded protein is a component of adaptor protein complex 1 (AP-1), one of the AP complexes involved in claathrin-mediated vesicular transport from the Golgi or endosomes. Disruption of the pathway for display of HIV-1 antigens, which prevents recognition of the virus by cytotoxic T cells, has been shown to involve the AP-1 complex (PMID: 15569716). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Ap1s3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Ap1s3 APN 1 79623722 missense possibly damaging 0.81
IGL02747:Ap1s3 APN 1 79623692 missense probably damaging 0.99
IGL03164:Ap1s3 APN 1 79625170 missense probably damaging 1.00
R2567:Ap1s3 UTSW 1 79625204 missense possibly damaging 0.91
R4647:Ap1s3 UTSW 1 79614203 splice site probably null
R4780:Ap1s3 UTSW 1 79609172 missense probably benign 0.00
R5958:Ap1s3 UTSW 1 79614243 missense probably benign
R6279:Ap1s3 UTSW 1 79625123 missense probably damaging 1.00
R6300:Ap1s3 UTSW 1 79625123 missense probably damaging 1.00
R7078:Ap1s3 UTSW 1 79625128 missense probably benign 0.00
R7135:Ap1s3 UTSW 1 79609202 missense probably benign
R7485:Ap1s3 UTSW 1 79614301 missense probably damaging 0.99
R7707:Ap1s3 UTSW 1 79614247 missense probably benign 0.00
R8378:Ap1s3 UTSW 1 79623728 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAATGTGGGTGCAGTCCTC -3'
(R):5'- AGGTCTAGAATTCTCTGCTCCC -3'

Sequencing Primer
(F):5'- GGTGCAGTCCTCAGTGTTAAC -3'
(R):5'- AGAATTCTCTGCTCCCATCTTTATG -3'
Posted On2018-06-06