Incidental Mutation 'R6538:Trem1'
ID520562
Institutional Source Beutler Lab
Gene Symbol Trem1
Ensembl Gene ENSMUSG00000042265
Gene Nametriggering receptor expressed on myeloid cells 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6538 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location48232768-48246924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48237090 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 48 (Y48H)
Ref Sequence ENSEMBL: ENSMUSP00000038636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048782] [ENSMUST00000113251]
PDB Structure
Crystal Structure of Mouse Triggering Receptor Expressed on Myeloid Cells 1 (TREM-1) at 1.76 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048782
AA Change: Y48H

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038636
Gene: ENSMUSG00000042265
AA Change: Y48H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 134 1.25e-4 SMART
low complexity region 159 170 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113251
SMART Domains Protein: ENSMUSP00000108877
Gene: ENSMUSG00000042265

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
transmembrane domain 83 105 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor belonging to the Ig superfamily that is expressed on myeloid cells. This protein amplifies neutrophil and monocyte-mediated inflammatory responses triggered by bacterial and fungal infections by stimulating release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit decreased susceptibility to DEN induced tumors and liver damage. Mice homozygous for a knock-out allele of Trem1 and Trem3 exhibit increased susceptibility to P. aeruginosa infection with reduced neutrophil transepithelial migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A G 10: 115,570,199 probably benign Het
Abcd4 T A 12: 84,611,761 M223L probably benign Het
Adat1 T C 8: 111,968,462 I482V probably benign Het
Arfgef2 A G 2: 166,893,621 probably null Het
Atn1 A G 6: 124,746,549 probably benign Het
Cyb561d2 C A 9: 107,540,017 M178I possibly damaging Het
Dnah14 A T 1: 181,584,985 H30L unknown Het
Dnah2 T C 11: 69,437,197 I3367V possibly damaging Het
Fcmr A G 1: 130,875,025 Y125C possibly damaging Het
Gm21731 T C 13: 120,240,932 V88A possibly damaging Het
Gm7298 G T 6: 121,776,173 V870L probably damaging Het
Gm9774 C T 3: 92,429,255 V47M possibly damaging Het
Grin3a T C 4: 49,770,856 S639G probably damaging Het
Hist1h1t A G 13: 23,695,921 E19G probably benign Het
Ighv9-1 T A 12: 114,094,065 T72S possibly damaging Het
Klra2 T A 6: 131,242,990 H76L probably damaging Het
Lamp1 A G 8: 13,171,285 T209A probably benign Het
Lrrc9 T A 12: 72,500,929 Y1294N probably benign Het
Olfr1094 A T 2: 86,829,525 T258S possibly damaging Het
Olfr222 C T 11: 59,571,585 V52I probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pik3ca T C 3: 32,439,704 Y272H probably damaging Het
Spindoc T C 19: 7,382,699 I35V probably benign Het
St6galnac4 A C 2: 32,597,078 M262L possibly damaging Het
Szt2 C T 4: 118,390,477 probably null Het
Trim38 A T 13: 23,785,949 T164S probably damaging Het
Zfp715 A T 7: 43,299,149 H462Q possibly damaging Het
Zfyve16 C T 13: 92,504,516 G1240E probably damaging Het
Other mutations in Trem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Trem1 APN 17 48237249 missense probably benign 0.14
IGL01729:Trem1 APN 17 48244575 missense possibly damaging 0.90
IGL01756:Trem1 APN 17 48237113 nonsense probably null
IGL02348:Trem1 APN 17 48232796 start codon destroyed probably null 1.00
IGL02720:Trem1 APN 17 48232841 missense probably benign 0.03
R0589:Trem1 UTSW 17 48237217 missense possibly damaging 0.93
R1807:Trem1 UTSW 17 48241635 nonsense probably null
R1878:Trem1 UTSW 17 48241488 missense possibly damaging 0.83
R4648:Trem1 UTSW 17 48244562 missense probably benign 0.10
R5121:Trem1 UTSW 17 48232836 missense probably null 0.00
R5387:Trem1 UTSW 17 48241513 missense possibly damaging 0.92
R5623:Trem1 UTSW 17 48237055 missense probably damaging 1.00
R5953:Trem1 UTSW 17 48237192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAAGTCCTTCCCAGTTGAG -3'
(R):5'- GAGCACAACAGGGTCATTCG -3'

Sequencing Primer
(F):5'- AGAGTTTGGACAGACGTCATTCCC -3'
(R):5'- CAATCCAGAGTCTGTCACTTGAAGG -3'
Posted On2018-06-06