Incidental Mutation 'R6539:Olfr1188'
ID520568
Institutional Source Beutler Lab
Gene Symbol Olfr1188
Ensembl Gene ENSMUSG00000068809
Gene Nameolfactory receptor 1188
SynonymsMOR238-2, GA_x6K02T2Q125-50046879-50047784
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88556935-88560815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88559520 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 6 (F6S)
Ref Sequence ENSEMBL: ENSMUSP00000150850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090701] [ENSMUST00000217131]
Predicted Effect probably damaging
Transcript: ENSMUST00000090701
AA Change: F17S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088202
Gene: ENSMUSG00000068809
AA Change: F17S

DomainStartEndE-ValueType
Pfam:7tm_4 36 309 5.9e-49 PFAM
Pfam:7tm_1 46 292 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217131
AA Change: F6S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Olfr1188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Olfr1188 APN 2 88560065 missense probably benign 0.02
R1525:Olfr1188 UTSW 2 88559641 missense probably damaging 1.00
R1530:Olfr1188 UTSW 2 88559483 missense probably benign 0.23
R1703:Olfr1188 UTSW 2 88560255 missense possibly damaging 0.56
R1750:Olfr1188 UTSW 2 88560058 missense possibly damaging 0.94
R4626:Olfr1188 UTSW 2 88559832 missense possibly damaging 0.69
R4645:Olfr1188 UTSW 2 88560378 missense probably damaging 0.98
R4934:Olfr1188 UTSW 2 88559586 missense probably benign 0.00
R5643:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R5644:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R7079:Olfr1188 UTSW 2 88559509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTTCCCTTTGGTATGGCATG -3'
(R):5'- ACCAGCATCTTAGGGATTGTGC -3'

Sequencing Primer
(F):5'- TGGTATGGCATGAAACAAAATAATTC -3'
(R):5'- TTGTGCAAGAGGAATAACATGCATC -3'
Posted On2018-06-06