Incidental Mutation 'R6515:Nutm1'
ID520569
Institutional Source Beutler Lab
Gene Symbol Nutm1
Ensembl Gene ENSMUSG00000041358
Gene NameNUT midline carcinoma, family member 1
SynonymsBC125332, Nut
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112247948-112259291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 112256320 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 22 (L22R)
Ref Sequence ENSEMBL: ENSMUSP00000048263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043970]
Predicted Effect probably benign
Transcript: ENSMUST00000043970
AA Change: L22R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048263
Gene: ENSMUSG00000041358
AA Change: L22R

DomainStartEndE-ValueType
Pfam:NUT 14 541 1.4e-210 PFAM
low complexity region 840 854 N/A INTRINSIC
Pfam:NUT 900 1123 6.7e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Nutm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Nutm1 APN 2 112251818 missense probably benign 0.36
IGL02190:Nutm1 APN 2 112249406 nonsense probably null
IGL02546:Nutm1 APN 2 112248324 missense probably benign 0.00
IGL02888:Nutm1 APN 2 112250635 missense probably damaging 1.00
IGL03062:Nutm1 APN 2 112248933 missense probably benign 0.16
R1024:Nutm1 UTSW 2 112249929 missense probably benign 0.35
R1314:Nutm1 UTSW 2 112249809 missense probably benign 0.10
R2061:Nutm1 UTSW 2 112255752 nonsense probably null
R4092:Nutm1 UTSW 2 112249464 missense probably damaging 1.00
R4402:Nutm1 UTSW 2 112249809 missense probably damaging 0.99
R4783:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R4784:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R4785:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R5184:Nutm1 UTSW 2 112249000 missense possibly damaging 0.57
R5662:Nutm1 UTSW 2 112249300 missense probably benign 0.01
R5922:Nutm1 UTSW 2 112249314 missense possibly damaging 0.93
R6053:Nutm1 UTSW 2 112249090 missense probably benign 0.01
R6344:Nutm1 UTSW 2 112248902 missense possibly damaging 0.91
R6410:Nutm1 UTSW 2 112248729 missense possibly damaging 0.75
R6516:Nutm1 UTSW 2 112251217 missense probably damaging 1.00
R6573:Nutm1 UTSW 2 112251043 critical splice donor site probably null
R6950:Nutm1 UTSW 2 112248559 missense probably benign 0.00
R6975:Nutm1 UTSW 2 112256218 missense probably damaging 1.00
R7033:Nutm1 UTSW 2 112256168 missense probably damaging 1.00
R7070:Nutm1 UTSW 2 112249461 missense probably benign
R7072:Nutm1 UTSW 2 112251847 missense probably benign 0.34
R7140:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7143:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7294:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7296:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7297:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7613:Nutm1 UTSW 2 112249239 missense probably benign 0.00
R8162:Nutm1 UTSW 2 112248472 missense probably benign 0.02
R8252:Nutm1 UTSW 2 112251829 missense probably damaging 1.00
X0065:Nutm1 UTSW 2 112248627 missense probably damaging 1.00
X0066:Nutm1 UTSW 2 112248357 missense probably damaging 1.00
Z1177:Nutm1 UTSW 2 112255716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAATGACCTGGCCAGTTC -3'
(R):5'- GTAAAGGACTGCTCCAGAGG -3'

Sequencing Primer
(F):5'- GCCAGTTCCAGCCACACTG -3'
(R):5'- AGAGGCACCCGTCCATGTC -3'
Posted On2018-06-06