Incidental Mutation 'R6515:Hspa4l'
ID520571
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Nameheat shock protein 4 like
Synonyms94kDa, Osp94, APG-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40744495-40796103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40781582 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 545 (D545G)
Ref Sequence ENSEMBL: ENSMUSP00000103721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108086
AA Change: D545G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: D545G

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203353
AA Change: D566G

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757
AA Change: D566G

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204174
Predicted Effect probably benign
Transcript: ENSMUST00000204702
AA Change: D566G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: D566G

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.2050 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40753225 nonsense probably null
IGL02605:Hspa4l APN 3 40781623 missense probably benign 0.20
IGL02719:Hspa4l APN 3 40772658 missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40785408 splice site probably benign
R0398:Hspa4l UTSW 3 40756997 splice site probably benign
R0487:Hspa4l UTSW 3 40784326 missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40779400 missense probably benign 0.01
R0760:Hspa4l UTSW 3 40784723 nonsense probably null
R1491:Hspa4l UTSW 3 40786794 missense probably benign 0.00
R1720:Hspa4l UTSW 3 40781617 nonsense probably null
R1984:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40772658 missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40785389 missense probably benign 0.29
R3874:Hspa4l UTSW 3 40772642 missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40781594 missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40746003 missense probably benign 0.03
R4364:Hspa4l UTSW 3 40766809 splice site probably null
R4365:Hspa4l UTSW 3 40766809 splice site probably null
R4366:Hspa4l UTSW 3 40766809 splice site probably null
R4493:Hspa4l UTSW 3 40768002 missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40753204 missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40785400 critical splice donor site probably null
R4994:Hspa4l UTSW 3 40745649 utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40745765 missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40786747 missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40781569 missense probably benign 0.17
R5440:Hspa4l UTSW 3 40781576 missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40745745 missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40767979 missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40781599 missense probably benign 0.09
R6589:Hspa4l UTSW 3 40757055 missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40781592 missense probably benign 0.00
R7601:Hspa4l UTSW 3 40784356 critical splice donor site probably null
R8072:Hspa4l UTSW 3 40786746 missense probably damaging 0.98
Z1088:Hspa4l UTSW 3 40766993 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGCAAATGTAGTAAAGGGTTAGC -3'
(R):5'- ACCTTTGACTCCAATACAGTATCAG -3'

Sequencing Primer
(F):5'- TTCCAGGCAAGCACTTTACTACTGAG -3'
(R):5'- TGACTCCAATACAGTATCAGAATGC -3'
Posted On2018-06-06