Incidental Mutation 'R6515:Sec24d'
ID520573
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene NameSec24 related gene family, member D (S. cerevisiae)
Synonyms2310020L09Rik, LOC383951
MMRRC Submission
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location123267455-123365641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123343070 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 484 (R484Q)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047923
AA Change: R484Q

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: R484Q

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGAAGCCTCATCTCGCTGGTAG -3'
(R):5'- GGTCTTCAAACACACATCTGATC -3'

Sequencing Primer
(F):5'- GCCTCATCTCGCTGGTAGAAAAATG -3'
(R):5'- TCTGATCTGCATCACACTGAAAG -3'
Posted On2018-06-06