Mutagenetix > Incidental Mutations

Incidental Mutation 'R6539:Fndc3b'

520574

Institutional Source

Beutler Lab

Gene Symbol

Fndc3b

Ensembl Gene

ENSMUSG00000039286

Gene Name

fibronectin type III domain containing 3B

Synonyms

fad104, 1600019O04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6539 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27416162-27711307 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 27538057 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 231 (G231R)

Ref Sequence

ENSEMBL: ENSMUSP00000141620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046157] [ENSMUST00000193779] [ENSMUST00000195008]

Predicted Effect

probably benign
Transcript: ENSMUST00000046157
AA Change: G231R

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000041495
Gene: ENSMUSG00000039286
AA Change: G231R

Domain	Start	End	E-Value	Type
low complexity region	119	132	N/A	INTRINSIC
low complexity region	152	163	N/A	INTRINSIC
low complexity region	224	246	N/A	INTRINSIC
FN3	279	368	6.29e-8	SMART
FN3	382	463	8.31e-8	SMART
FN3	478	560	3.15e-8	SMART
FN3	575	659	4.28e-10	SMART
FN3	674	755	2.14e-10	SMART
FN3	770	849	1.98e-5	SMART
FN3	872	947	1.31e-5	SMART
FN3	961	1042	2.31e-6	SMART
FN3	1057	1137	1.2e-4	SMART
low complexity region	1165	1176	N/A	INTRINSIC
transmembrane domain	1182	1204	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191684

Predicted Effect

probably benign
Transcript: ENSMUST00000193779

SMART Domains

Protein: ENSMUSP00000141888
Gene: ENSMUSG00000039286

Domain	Start	End	E-Value	Type
PDB:1WK0\|A	67	117	2e-6	PDB
Blast:FN3	75	119	2e-25	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000195008
AA Change: G231R

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000141620
Gene: ENSMUSG00000039286
AA Change: G231R

Domain	Start	End	E-Value	Type
low complexity region	119	132	N/A	INTRINSIC
low complexity region	152	163	N/A	INTRINSIC
low complexity region	224	246	N/A	INTRINSIC
FN3	279	368	6.29e-8	SMART
FN3	382	463	8.31e-8	SMART
FN3	478	560	3.15e-8	SMART
FN3	575	659	4.28e-10	SMART
FN3	674	755	2.14e-10	SMART
FN3	770	849	1.98e-5	SMART
FN3	872	947	1.31e-5	SMART
FN3	961	1042	2.31e-6	SMART
FN3	1057	1137	1.2e-4	SMART
low complexity region	1165	1176	N/A	INTRINSIC
transmembrane domain	1182	1204	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (46/46)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth despite normal energy homeostasis. Mouse embryonic fibroblasts homozygous for a knock-out allele exhibit impaired adipogenesis and enhanced osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	A	G	10: 77,984,488	T231A	probably benign	Het
Adam5	G	A	8: 24,782,600	A513V	possibly damaging	Het
Ano8	T	C	8: 71,484,483	D147G	probably damaging	Het
Apba1	A	G	19: 23,936,560	D649G	probably damaging	Het
Atp6v0d1	T	C	8: 105,524,974	I329V	probably benign	Het
Card6	T	A	15: 5,105,391	N110I	probably damaging	Het
Chn2	T	A	6: 54,173,461		probably null	Het
Cyp46a1	G	A	12: 108,353,157		probably null	Het
Daam2	T	A	17: 49,469,711	H782L	probably damaging	Het
Defa26	A	G	8: 21,618,246	I22V	possibly damaging	Het
Dlk1	A	G	12: 109,460,319	M278V	probably benign	Het
Dync2h1	T	C	9: 7,159,478		probably null	Het
Ehmt1	T	A	2: 24,804,767	H1056L	probably damaging	Het
Ephb3	G	A	16: 21,221,468	D527N	probably benign	Het
Fam46a	T	C	9: 85,326,561	I70V	possibly damaging	Het
Flt1	T	C	5: 147,578,376	K1079E	probably benign	Het
Gm4924	T	A	10: 82,378,524		probably benign	Het
Ifrd1	G	A	12: 40,203,435	A426V	probably damaging	Het
Ift140	T	C	17: 25,094,669	L1358P	possibly damaging	Het
Igkv5-37	A	T	6: 69,963,816	S16T	probably benign	Het
Map3k9	A	G	12: 81,732,192	L449P	probably damaging	Het
Mdm1	T	C	10: 118,150,958		probably null	Het
Mmrn1	A	T	6: 60,987,184	T1056S	probably benign	Het
Mroh2b	C	T	15: 4,905,574	H164Y	probably damaging	Het
Muc16	T	C	9: 18,637,325	T5891A	probably benign	Het
Nagpa	T	C	16: 5,203,701	E62G	possibly damaging	Het
Nek10	T	A	14: 14,860,789	V475D	possibly damaging	Het
Olfr1188	T	C	2: 88,559,520	F6S	probably damaging	Het
Olfr194	A	C	16: 59,119,751	S106R	probably damaging	Het
Pan3	T	C	5: 147,450,653	I144T	possibly damaging	Het
Parvg	T	A	15: 84,341,340	D349E	probably damaging	Het
Pitpna	A	G	11: 75,598,301	Y58C	probably damaging	Het
Ppp4r3b	T	A	11: 29,218,503	D73E	probably benign	Het
Preb	A	G	5: 30,956,076	V338A	probably benign	Het
Sec23a	T	C	12: 58,985,212	T411A	probably benign	Het
Smc6	A	G	12: 11,297,010		probably null	Het
Stxbp5l	A	G	16: 37,129,815	M1056T	probably damaging	Het
Tbcd	T	A	11: 121,556,987		probably null	Het
Tpx2	G	T	2: 152,876,598	E174*	probably null	Het
Trpc4ap	G	T	2: 155,636,258	P663T	probably benign	Het
Unc5cl	G	A	17: 48,465,017	G441D	probably damaging	Het
Xrcc2	G	T	5: 25,692,532	R140S	probably benign	Het
Zfc3h1	G	A	10: 115,412,002	E1037K	probably benign	Het
Zfhx4	A	T	3: 5,244,108	Q798L	probably damaging	Het
Zfp94	G	A	7: 24,303,291	T236M	probably damaging	Het

Other mutations in Fndc3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Fndc3b	APN	3	27538012	missense	probably benign	0.40
IGL00848:Fndc3b	APN	3	27451509	missense	probably damaging	1.00
IGL01099:Fndc3b	APN	3	27463817	missense	probably benign	0.10
IGL01459:Fndc3b	APN	3	27461740	missense	probably benign	0.11
IGL01583:Fndc3b	APN	3	27428995	missense	probably damaging	1.00
IGL01736:Fndc3b	APN	3	27467403	missense	probably damaging	1.00
IGL02154:Fndc3b	APN	3	27538117	missense	probably damaging	0.99
IGL02377:Fndc3b	APN	3	27620652	missense	probably damaging	1.00
IGL02470:Fndc3b	APN	3	27461720	missense	probably damaging	1.00
IGL02508:Fndc3b	APN	3	27458751	missense	probably damaging	1.00
IGL02834:Fndc3b	APN	3	27508503	missense	probably damaging	1.00
IGL02974:Fndc3b	APN	3	27488276	missense	probably damaging	1.00
IGL02999:Fndc3b	APN	3	27538239	missense	probably damaging	1.00
IGL03083:Fndc3b	APN	3	27467427	missense	probably benign	0.10
R0040:Fndc3b	UTSW	3	27556117	splice site	probably null
R0040:Fndc3b	UTSW	3	27556117	splice site	probably null
R0101:Fndc3b	UTSW	3	27458808	missense	probably damaging	1.00
R0279:Fndc3b	UTSW	3	27457006	missense	probably benign	0.30
R0281:Fndc3b	UTSW	3	27457006	missense	probably benign	0.30
R0325:Fndc3b	UTSW	3	27467430	missense	probably damaging	1.00
R0398:Fndc3b	UTSW	3	27461779	missense	probably benign	0.19
R1334:Fndc3b	UTSW	3	27458851	missense	probably damaging	1.00
R1464:Fndc3b	UTSW	3	27440185	splice site	probably benign
R1961:Fndc3b	UTSW	3	27456451	nonsense	probably null
R1993:Fndc3b	UTSW	3	27419400	missense	probably benign
R2087:Fndc3b	UTSW	3	27451554	missense	probably benign	0.00
R2113:Fndc3b	UTSW	3	27643036	missense	probably damaging	1.00
R2258:Fndc3b	UTSW	3	27440160	missense	possibly damaging	0.93
R2437:Fndc3b	UTSW	3	27451332	missense	probably damaging	0.99
R2930:Fndc3b	UTSW	3	27470286	missense	probably benign
R2997:Fndc3b	UTSW	3	27468872	missense	probably benign	0.00
R3151:Fndc3b	UTSW	3	27419503	missense	possibly damaging	0.93
R3782:Fndc3b	UTSW	3	27459986	missense	possibly damaging	0.81
R4255:Fndc3b	UTSW	3	27501407	missense	possibly damaging	0.77
R4628:Fndc3b	UTSW	3	27556128	missense	probably benign	0.19
R4747:Fndc3b	UTSW	3	27428965	missense	probably damaging	0.98
R4849:Fndc3b	UTSW	3	27459948	missense	probably damaging	1.00
R5185:Fndc3b	UTSW	3	27457070	missense	probably benign	0.14
R5291:Fndc3b	UTSW	3	27642995	missense	probably benign	0.39
R5392:Fndc3b	UTSW	3	27465787	nonsense	probably null
R5540:Fndc3b	UTSW	3	27501502	missense	probably damaging	1.00
R5554:Fndc3b	UTSW	3	27643013	missense	possibly damaging	0.69
R5635:Fndc3b	UTSW	3	27541931	missense	probably damaging	1.00
R5639:Fndc3b	UTSW	3	27426153	missense	probably damaging	0.98
R5678:Fndc3b	UTSW	3	27429023	missense	probably benign
R5732:Fndc3b	UTSW	3	27461773	missense	probably damaging	1.00
R5880:Fndc3b	UTSW	3	27428903	missense	probably damaging	1.00
R7038:Fndc3b	UTSW	3	27501469	missense	probably benign	0.23
R7102:Fndc3b	UTSW	3	27470234	missense	possibly damaging	0.73
R7203:Fndc3b	UTSW	3	27456485	missense	probably benign	0.00
R7472:Fndc3b	UTSW	3	27461744	missense	probably benign	0.00
X0028:Fndc3b	UTSW	3	27451434	missense	possibly damaging	0.72
Z1088:Fndc3b	UTSW	3	27465808	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ACCTGAGATAAAGCTCCCCTG -3'
(R):5'- GGTGGCAGATGTAAACTAAGCTTG -3'

Sequencing Primer
(F):5'- TCCCCTGGGAGAGATGGG -3'
(R):5'- AATTATCCCCCTGTATGGAATGTCG -3'

Posted On

2018-06-06