Incidental Mutation 'R6539:Preb'
ID520578
Institutional Source Beutler Lab
Gene Symbol Preb
Ensembl Gene ENSMUSG00000045302
Gene Nameprolactin regulatory element binding
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30950853-30960361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30956076 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 338 (V338A)
Ref Sequence ENSEMBL: ENSMUSP00000074387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074840] [ENSMUST00000202567]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000006814
SMART Domains Protein: ENSMUSP00000143649
Gene: ENSMUSG00000006638

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Hydrolase_4 127 371 1.3e-9 PFAM
Pfam:Abhydrolase_1 131 373 1.4e-12 PFAM
Pfam:Abhydrolase_5 132 367 2.8e-8 PFAM
Pfam:Abhydrolase_6 133 377 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074840
AA Change: V338A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074387
Gene: ENSMUSG00000045302
AA Change: V338A

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 99 114 N/A INTRINSIC
WD40 143 182 4.48e-2 SMART
WD40 185 223 4.88e-3 SMART
WD40 289 328 4.42e1 SMART
Blast:WD40 332 382 5e-26 BLAST
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200836
Predicted Effect probably benign
Transcript: ENSMUST00000201002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201730
Predicted Effect probably benign
Transcript: ENSMUST00000201821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202472
Predicted Effect probably benign
Transcript: ENSMUST00000202567
SMART Domains Protein: ENSMUSP00000144263
Gene: ENSMUSG00000045302

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 99 114 N/A INTRINSIC
WD40 143 182 4.48e-2 SMART
WD40 185 223 4.88e-3 SMART
WD40 289 328 4.42e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202930
Meta Mutation Damage Score 0.1098 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that specifically binds to a Pit1-binding element of the prolactin (PRL) promoter. This protein may act as a transcriptional regulator and is thought to be involved in some of the developmental abnormalities observed in patients with partial trisomy 2p. This gene overlaps the abhydrolase domain containing 1 (ABHD1) gene on the opposite strand. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Preb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Preb APN 5 30955964 missense probably damaging 1.00
IGL01344:Preb APN 5 30956044 missense probably damaging 0.99
IGL03383:Preb APN 5 30958321 missense probably damaging 1.00
R1520:Preb UTSW 5 30958524 missense probably benign 0.14
R1987:Preb UTSW 5 30958813 missense probably damaging 1.00
R2327:Preb UTSW 5 30958505 missense probably damaging 0.99
R5607:Preb UTSW 5 30959963 splice site probably benign
R5769:Preb UTSW 5 30958291 nonsense probably null
R5831:Preb UTSW 5 30958864 missense probably benign
R6271:Preb UTSW 5 30958051 missense probably damaging 0.99
R7575:Preb UTSW 5 30958495 missense probably damaging 1.00
X0065:Preb UTSW 5 30958936 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAAGTGGTACCCTCCCTGC -3'
(R):5'- GCTCTGTCGCCATCTACATAGC -3'

Sequencing Primer
(F):5'- GGTACCCTCCCTGCCAACAC -3'
(R):5'- CCAGGTAATGGCAGCGGTTG -3'
Posted On2018-06-06