Mutagenetix > Incidental Mutations

Incidental Mutation 'R6539:Preb'

520578

Institutional Source

Beutler Lab

Gene Symbol

Preb

Ensembl Gene

ENSMUSG00000045302

Gene Name

prolactin regulatory element binding

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.944) question?

Stock #

R6539 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30950853-30960361 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30956076 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 338 (V338A)

Ref Sequence

ENSEMBL: ENSMUSP00000074387 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074840] [ENSMUST00000202567]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000006814

SMART Domains

Protein: ENSMUSP00000143649
Gene: ENSMUSG00000006638

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Hydrolase_4	127	371	1.3e-9	PFAM
Pfam:Abhydrolase_1	131	373	1.4e-12	PFAM
Pfam:Abhydrolase_5	132	367	2.8e-8	PFAM
Pfam:Abhydrolase_6	133	377	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074840
AA Change: V338A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000074387
Gene: ENSMUSG00000045302
AA Change: V338A

Domain	Start	End	E-Value	Type
low complexity region	24	41	N/A	INTRINSIC
low complexity region	99	114	N/A	INTRINSIC
WD40	143	182	4.48e-2	SMART
WD40	185	223	4.88e-3	SMART
WD40	289	328	4.42e1	SMART
Blast:WD40	332	382	5e-26	BLAST
transmembrane domain	391	413	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200756

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200836

Predicted Effect

probably benign
Transcript: ENSMUST00000201002

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201339

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201730

Predicted Effect

probably benign
Transcript: ENSMUST00000201821

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202013

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202401

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202445

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202472

Predicted Effect

probably benign
Transcript: ENSMUST00000202567

SMART Domains

Protein: ENSMUSP00000144263
Gene: ENSMUSG00000045302

Domain	Start	End	E-Value	Type
low complexity region	24	41	N/A	INTRINSIC
low complexity region	99	114	N/A	INTRINSIC
WD40	143	182	4.48e-2	SMART
WD40	185	223	4.88e-3	SMART
WD40	289	328	4.42e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202904

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202930

Meta Mutation Damage Score

0.1098

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that specifically binds to a Pit1-binding element of the prolactin (PRL) promoter. This protein may act as a transcriptional regulator and is thought to be involved in some of the developmental abnormalities observed in patients with partial trisomy 2p. This gene overlaps the abhydrolase domain containing 1 (ABHD1) gene on the opposite strand. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	A	G	10: 77,984,488	T231A	probably benign	Het
Adam5	G	A	8: 24,782,600	A513V	possibly damaging	Het
Ano8	T	C	8: 71,484,483	D147G	probably damaging	Het
Apba1	A	G	19: 23,936,560	D649G	probably damaging	Het
Atp6v0d1	T	C	8: 105,524,974	I329V	probably benign	Het
Card6	T	A	15: 5,105,391	N110I	probably damaging	Het
Chn2	T	A	6: 54,173,461		probably null	Het
Cyp46a1	G	A	12: 108,353,157		probably null	Het
Daam2	T	A	17: 49,469,711	H782L	probably damaging	Het
Defa26	A	G	8: 21,618,246	I22V	possibly damaging	Het
Dlk1	A	G	12: 109,460,319	M278V	probably benign	Het
Dync2h1	T	C	9: 7,159,478		probably null	Het
Ehmt1	T	A	2: 24,804,767	H1056L	probably damaging	Het
Ephb3	G	A	16: 21,221,468	D527N	probably benign	Het
Fam46a	T	C	9: 85,326,561	I70V	possibly damaging	Het
Flt1	T	C	5: 147,578,376	K1079E	probably benign	Het
Fndc3b	C	T	3: 27,538,057	G231R	probably benign	Het
Gm4924	T	A	10: 82,378,524		probably benign	Het
Ifrd1	G	A	12: 40,203,435	A426V	probably damaging	Het
Ift140	T	C	17: 25,094,669	L1358P	possibly damaging	Het
Igkv5-37	A	T	6: 69,963,816	S16T	probably benign	Het
Map3k9	A	G	12: 81,732,192	L449P	probably damaging	Het
Mdm1	T	C	10: 118,150,958		probably null	Het
Mmrn1	A	T	6: 60,987,184	T1056S	probably benign	Het
Mroh2b	C	T	15: 4,905,574	H164Y	probably damaging	Het
Muc16	T	C	9: 18,637,325	T5891A	probably benign	Het
Nagpa	T	C	16: 5,203,701	E62G	possibly damaging	Het
Nek10	T	A	14: 14,860,789	V475D	possibly damaging	Het
Olfr1188	T	C	2: 88,559,520	F6S	probably damaging	Het
Olfr194	A	C	16: 59,119,751	S106R	probably damaging	Het
Pan3	T	C	5: 147,450,653	I144T	possibly damaging	Het
Parvg	T	A	15: 84,341,340	D349E	probably damaging	Het
Pitpna	A	G	11: 75,598,301	Y58C	probably damaging	Het
Ppp4r3b	T	A	11: 29,218,503	D73E	probably benign	Het
Sec23a	T	C	12: 58,985,212	T411A	probably benign	Het
Smc6	A	G	12: 11,297,010		probably null	Het
Stxbp5l	A	G	16: 37,129,815	M1056T	probably damaging	Het
Tbcd	T	A	11: 121,556,987		probably null	Het
Tpx2	G	T	2: 152,876,598	E174*	probably null	Het
Trpc4ap	G	T	2: 155,636,258	P663T	probably benign	Het
Unc5cl	G	A	17: 48,465,017	G441D	probably damaging	Het
Xrcc2	G	T	5: 25,692,532	R140S	probably benign	Het
Zfc3h1	G	A	10: 115,412,002	E1037K	probably benign	Het
Zfhx4	A	T	3: 5,244,108	Q798L	probably damaging	Het
Zfp94	G	A	7: 24,303,291	T236M	probably damaging	Het

Other mutations in Preb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Preb	APN	5	30955964	missense	probably damaging	1.00
IGL01344:Preb	APN	5	30956044	missense	probably damaging	0.99
IGL03383:Preb	APN	5	30958321	missense	probably damaging	1.00
R1520:Preb	UTSW	5	30958524	missense	probably benign	0.14
R1987:Preb	UTSW	5	30958813	missense	probably damaging	1.00
R2327:Preb	UTSW	5	30958505	missense	probably damaging	0.99
R5607:Preb	UTSW	5	30959963	splice site	probably benign
R5769:Preb	UTSW	5	30958291	nonsense	probably null
R5831:Preb	UTSW	5	30958864	missense	probably benign
R6271:Preb	UTSW	5	30958051	missense	probably damaging	0.99
R7575:Preb	UTSW	5	30958495	missense	probably damaging	1.00
X0065:Preb	UTSW	5	30958936	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TAAAGTGGTACCCTCCCTGC -3'
(R):5'- GCTCTGTCGCCATCTACATAGC -3'

Sequencing Primer
(F):5'- GGTACCCTCCCTGCCAACAC -3'
(R):5'- CCAGGTAATGGCAGCGGTTG -3'

Posted On

2018-06-06