Incidental Mutation 'R6515:Olfr1337'
ID520579
Institutional Source Beutler Lab
Gene Symbol Olfr1337
Ensembl Gene ENSMUSG00000111159
Gene Nameolfactory receptor 1337
SynonymsGA_x6K02T2QD9B-18767132-18768073, Olfr219-ps1, GA_x6K02SYWGW3-414-3, MOR259-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118781636-118782586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118782270 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 105 (Y105C)
Ref Sequence ENSEMBL: ENSMUSP00000076483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077247]
Predicted Effect probably benign
Transcript: ENSMUST00000077247
AA Change: Y105C

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076483
Gene: ENSMUSG00000111159
AA Change: Y105C

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 7.8e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.5e-7 PFAM
Pfam:7tm_1 44 293 8.3e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Olfr1337
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Olfr1337 APN 4 118782429 missense possibly damaging 0.95
IGL02626:Olfr1337 APN 4 118782334 missense probably damaging 0.98
IGL02699:Olfr1337 APN 4 118782152 nonsense probably null
IGL02754:Olfr1337 APN 4 118781920 missense possibly damaging 0.90
IGL03287:Olfr1337 APN 4 118782354 missense possibly damaging 0.64
R1341:Olfr1337 UTSW 4 118782382 missense probably benign 0.01
R4894:Olfr1337 UTSW 4 118782286 missense probably damaging 1.00
R6124:Olfr1337 UTSW 4 118782195 missense probably damaging 1.00
R6529:Olfr1337 UTSW 4 118781710 missense probably benign 0.15
R7040:Olfr1337 UTSW 4 118781986 missense probably benign 0.00
R7398:Olfr1337 UTSW 4 118781699 missense possibly damaging 0.80
R7684:Olfr1337 UTSW 4 118782274 missense probably benign 0.40
R8377:Olfr1337 UTSW 4 118782006 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGCAGACTCATGGTGAAG -3'
(R):5'- ATGTACCTGAGCTCAGTCCTG -3'

Sequencing Primer
(F):5'- ACTCATGGTGAAGAAAGTATGTAAC -3'
(R):5'- GCAATGGGCTCATCATCATG -3'
Posted On2018-06-06