Incidental Mutation 'R6539:Chn2'
ID520584
Institutional Source Beutler Lab
Gene Symbol Chn2
Ensembl Gene ENSMUSG00000004633
Gene Namechimerin 2
Synonyms4930557O16Rik, 1700026N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R6539 (G1)
Quality Score170.009
Status Validated
Chromosome6
Chromosomal Location54039554-54301810 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 54173461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046856] [ENSMUST00000127323] [ENSMUST00000133315]
Predicted Effect probably null
Transcript: ENSMUST00000046856
SMART Domains Protein: ENSMUSP00000035908
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SH2 57 136 7.23e-16 SMART
C1 215 264 1.88e-15 SMART
RhoGAP 288 465 2.73e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114403
SMART Domains Protein: ENSMUSP00000110045
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SH2 57 136 7.23e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127323
SMART Domains Protein: ENSMUSP00000118990
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Blast:RhoGAP 17 49 3e-16 BLAST
PDB:1XA6|A 17 58 1e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133315
SMART Domains Protein: ENSMUSP00000145072
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Blast:RhoGAP 17 49 8e-17 BLAST
PDB:1XA6|A 17 49 1e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204410
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired infrapyramidal tract neuron prunning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Chn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chn2 APN 6 54295922 critical splice donor site probably null
IGL02158:Chn2 APN 6 54300245 unclassified probably benign
IGL02618:Chn2 APN 6 54220437 missense probably damaging 1.00
IGL02807:Chn2 APN 6 54295913 missense possibly damaging 0.80
IGL03357:Chn2 APN 6 54194077 missense probably benign 0.02
R0002:Chn2 UTSW 6 54273113 missense probably benign 0.08
R0123:Chn2 UTSW 6 54290451 splice site probably benign
R0225:Chn2 UTSW 6 54290451 splice site probably benign
R1478:Chn2 UTSW 6 54293080 missense probably damaging 1.00
R1905:Chn2 UTSW 6 54286121 missense probably damaging 1.00
R3769:Chn2 UTSW 6 54290411 missense probably damaging 1.00
R3946:Chn2 UTSW 6 54269426 unclassified probably benign
R4125:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4127:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4128:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4614:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R4616:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R5063:Chn2 UTSW 6 54290287 nonsense probably null
R5121:Chn2 UTSW 6 54218561 missense possibly damaging 0.57
R5208:Chn2 UTSW 6 54295801 missense probably damaging 0.97
R5240:Chn2 UTSW 6 54220695 missense probably benign
R5348:Chn2 UTSW 6 54300218 missense probably damaging 0.99
R5861:Chn2 UTSW 6 54290374 missense probably damaging 1.00
R6824:Chn2 UTSW 6 54272953 missense probably benign 0.00
R7194:Chn2 UTSW 6 54286177 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTGCTCCGAAGAGACTGTTG -3'
(R):5'- CAGAGACTGACAGAGCTAACTCTC -3'

Sequencing Primer
(F):5'- ACTGTTGATGCGTCCACAAG -3'
(R):5'- TAACTCTCTCCTCAGTGAAGGGAAG -3'
Posted On2018-06-06