Incidental Mutation 'R6539:Zfp94'
ID520590
Institutional Source Beutler Lab
Gene Symbol Zfp94
Ensembl Gene ENSMUSG00000074282
Gene Namezinc finger protein 94
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24301704-24316666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24303291 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 236 (T236M)
Ref Sequence ENSEMBL: ENSMUSP00000032673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032673] [ENSMUST00000077780] [ENSMUST00000108436] [ENSMUST00000145131]
Predicted Effect probably damaging
Transcript: ENSMUST00000032673
AA Change: T236M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032673
Gene: ENSMUSG00000074282
AA Change: T236M

DomainStartEndE-ValueType
KRAB 2 59 3.06e-19 SMART
ZnF_C2H2 157 179 5.06e-2 SMART
ZnF_C2H2 185 207 8.47e-4 SMART
ZnF_C2H2 213 235 4.72e-2 SMART
ZnF_C2H2 241 263 1.28e-3 SMART
ZnF_C2H2 269 291 5.21e-4 SMART
ZnF_C2H2 297 319 9.08e-4 SMART
ZnF_C2H2 325 347 2.09e-3 SMART
ZnF_C2H2 353 375 8.94e-3 SMART
ZnF_C2H2 381 403 2.4e-3 SMART
ZnF_C2H2 409 431 8.6e-5 SMART
ZnF_C2H2 437 459 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077780
SMART Domains Protein: ENSMUSP00000076954
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 63 2.28e-27 SMART
ZnF_C2H2 311 333 1.4e-4 SMART
ZnF_C2H2 339 361 5.5e-3 SMART
ZnF_C2H2 367 389 2.99e-4 SMART
ZnF_C2H2 395 417 1.18e-2 SMART
ZnF_C2H2 423 445 2.4e-3 SMART
ZnF_C2H2 451 473 2.95e-3 SMART
ZnF_C2H2 479 501 9.88e-5 SMART
ZnF_C2H2 507 529 1.5e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108436
AA Change: T242M

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104075
Gene: ENSMUSG00000074282
AA Change: T242M

DomainStartEndE-ValueType
KRAB 8 65 3.06e-19 SMART
ZnF_C2H2 163 185 5.06e-2 SMART
ZnF_C2H2 191 213 8.47e-4 SMART
ZnF_C2H2 219 241 4.72e-2 SMART
ZnF_C2H2 247 269 1.28e-3 SMART
ZnF_C2H2 275 297 5.21e-4 SMART
ZnF_C2H2 303 325 9.08e-4 SMART
ZnF_C2H2 331 353 2.09e-3 SMART
ZnF_C2H2 359 381 8.94e-3 SMART
ZnF_C2H2 387 409 2.4e-3 SMART
ZnF_C2H2 415 437 8.6e-5 SMART
ZnF_C2H2 443 465 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139811
Predicted Effect probably benign
Transcript: ENSMUST00000145131
SMART Domains Protein: ENSMUSP00000117077
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 64 4.63e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206535
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Other mutations in Zfp94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Zfp94 APN 7 24311481 utr 5 prime probably benign
IGL02645:Zfp94 APN 7 24303754 missense probably benign
R0684:Zfp94 UTSW 7 24303070 missense probably damaging 1.00
R1177:Zfp94 UTSW 7 24303528 missense probably damaging 1.00
R1644:Zfp94 UTSW 7 24311502 splice site probably benign
R1675:Zfp94 UTSW 7 24302834 missense probably damaging 1.00
R1826:Zfp94 UTSW 7 24309115 missense probably damaging 1.00
R1861:Zfp94 UTSW 7 24309116 missense probably damaging 1.00
R3932:Zfp94 UTSW 7 24303687 missense probably benign 0.06
R4912:Zfp94 UTSW 7 24303741 missense probably benign 0.05
R5663:Zfp94 UTSW 7 24302827 missense probably damaging 1.00
R7023:Zfp94 UTSW 7 24303396 missense probably damaging 1.00
R7710:Zfp94 UTSW 7 24303682 missense probably benign
R7810:Zfp94 UTSW 7 24303073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAAGGCTTTCCCACACGTCTC -3'
(R):5'- TCGGTTATCGGGTCTCCAAG -3'

Sequencing Primer
(F):5'- CACACGTCTCACACTTATAGGG -3'
(R):5'- TCTCCAAGCCCATCAGGTGAG -3'
Posted On2018-06-06