Incidental Mutation 'R6515:Ggcx'
ID520593
Institutional Source Beutler Lab
Gene Symbol Ggcx
Ensembl Gene ENSMUSG00000053460
Gene Namegamma-glutamyl carboxylase
Synonymsvitamin K-dependent carboxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location72414308-72430712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72425832 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 258 (C258R)
Ref Sequence ENSEMBL: ENSMUSP00000070109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065906] [ENSMUST00000205738]
Predicted Effect probably benign
Transcript: ENSMUST00000065906
AA Change: C258R

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: C258R

DomainStartEndE-ValueType
HTTM 56 315 1.34e-131 SMART
low complexity region 368 377 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132995
Predicted Effect probably benign
Transcript: ENSMUST00000205738
Predicted Effect probably benign
Transcript: ENSMUST00000207000
Predicted Effect probably benign
Transcript: ENSMUST00000207012
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Ggcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Ggcx APN 6 72429958 splice site probably null
IGL02373:Ggcx APN 6 72427919 missense probably damaging 1.00
IGL02589:Ggcx APN 6 72429148 missense probably damaging 1.00
IGL02634:Ggcx APN 6 72418303 missense probably damaging 1.00
IGL02661:Ggcx APN 6 72418360 missense possibly damaging 0.78
IGL02701:Ggcx APN 6 72418472 intron probably benign
R0503:Ggcx UTSW 6 72429157 frame shift probably null
R1034:Ggcx UTSW 6 72414831 missense probably damaging 1.00
R2219:Ggcx UTSW 6 72427982 missense probably benign 0.29
R3892:Ggcx UTSW 6 72418372 missense probably damaging 0.99
R3951:Ggcx UTSW 6 72426558 missense probably benign 0.01
R3952:Ggcx UTSW 6 72426558 missense probably benign 0.01
R4320:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4321:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4322:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4324:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4782:Ggcx UTSW 6 72428892 missense probably benign 0.01
R5370:Ggcx UTSW 6 72425931 missense possibly damaging 0.69
R5523:Ggcx UTSW 6 72424034 missense probably damaging 1.00
R5902:Ggcx UTSW 6 72429996 missense possibly damaging 0.92
R6126:Ggcx UTSW 6 72417983 missense possibly damaging 0.57
R6199:Ggcx UTSW 6 72430139 missense possibly damaging 0.57
R6223:Ggcx UTSW 6 72429605 missense probably damaging 0.97
R7205:Ggcx UTSW 6 72428004 missense probably damaging 1.00
R7923:Ggcx UTSW 6 72427917 missense probably damaging 1.00
R8034:Ggcx UTSW 6 72428604 missense possibly damaging 0.47
R8096:Ggcx UTSW 6 72429993 missense probably benign 0.33
R8116:Ggcx UTSW 6 72429528 missense possibly damaging 0.66
Z1177:Ggcx UTSW 6 72426519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TAGTTGTTGTACCCCACTGCTG -3'
(R):5'- GCAGTGACCATACTGGGTTCAC -3'

Sequencing Primer
(F):5'- TGGGCAGATCCTTCGTCAG -3'
(R):5'- GGATCACCATCCCCAGTTG -3'
Posted On2018-06-06