Incidental Mutation 'R6515:Klra17'
ID520595
Institutional Source Beutler Lab
Gene Symbol Klra17
Ensembl Gene ENSMUSG00000014543
Gene Namekiller cell lectin-like receptor, subfamily A, member 17
SynonymsLy49q1, Ly-49Q, Ly49Q
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location129831154-129876672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129831499 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 257 (I257N)
Ref Sequence ENSEMBL: ENSMUSP00000114108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014687] [ENSMUST00000122219]
Predicted Effect probably damaging
Transcript: ENSMUST00000014687
AA Change: I257N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014687
Gene: ENSMUSG00000014543
AA Change: I257N

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
Blast:CLECT 73 126 2e-12 BLAST
CLECT 144 259 1.5e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122219
AA Change: I257N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114108
Gene: ENSMUSG00000014543
AA Change: I257N

DomainStartEndE-ValueType
low complexity region 53 70 N/A INTRINSIC
Blast:CLECT 74 127 2e-12 BLAST
CLECT 145 260 1.5e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit reduced plasmacytoid dendritic cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Klra17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Klra17 APN 6 129831509 missense probably benign 0.12
IGL02084:Klra17 APN 6 129831593 missense probably damaging 1.00
IGL02995:Klra17 APN 6 129868684 critical splice donor site probably null
IGL03238:Klra17 APN 6 129868810 missense probably benign 0.43
R0118:Klra17 UTSW 6 129831589 missense probably benign 0.01
R0583:Klra17 UTSW 6 129868693 missense probably damaging 1.00
R1103:Klra17 UTSW 6 129868843 unclassified probably benign
R1378:Klra17 UTSW 6 129865684 missense probably damaging 0.96
R1513:Klra17 UTSW 6 129872314 missense possibly damaging 0.61
R1817:Klra17 UTSW 6 129868718 unclassified probably null
R2262:Klra17 UTSW 6 129874794 critical splice donor site probably null
R2446:Klra17 UTSW 6 129831514 missense probably benign 0.02
R2484:Klra17 UTSW 6 129868757 missense probably damaging 1.00
R3410:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3411:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3739:Klra17 UTSW 6 129873365 missense probably benign 0.03
R4747:Klra17 UTSW 6 129872269 missense probably damaging 0.97
R4956:Klra17 UTSW 6 129873316 missense probably damaging 1.00
R5079:Klra17 UTSW 6 129872196 missense possibly damaging 0.72
R5310:Klra17 UTSW 6 129868708 missense probably damaging 1.00
R5366:Klra17 UTSW 6 129874895 missense possibly damaging 0.89
R5875:Klra17 UTSW 6 129874828 missense probably benign 0.01
R6043:Klra17 UTSW 6 129872187 critical splice donor site probably null
R6675:Klra17 UTSW 6 129872323 missense probably damaging 0.99
R7201:Klra17 UTSW 6 129873343 missense possibly damaging 0.62
R7296:Klra17 UTSW 6 129831592 missense possibly damaging 0.95
R8141:Klra17 UTSW 6 129872329 missense probably damaging 1.00
R8260:Klra17 UTSW 6 129831458 missense probably damaging 0.99
R8399:Klra17 UTSW 6 129874937 splice site probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGCCACATCAGATTCCAGG -3'
(R):5'- TCCGTATACTTTGGCCAATGG -3'

Sequencing Primer
(F):5'- GGAACATTCCTGACCTCTTCCAG -3'
(R):5'- TGGCCAATGGAATTTTTAAAATCATG -3'
Posted On2018-06-06