Incidental Mutation 'R6515:Ppfia3'
ID520599
Institutional Source Beutler Lab
Gene Symbol Ppfia3
Ensembl Gene ENSMUSG00000003863
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45339122-45367019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45340233 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1185 (D1185G)
Ref Sequence ENSEMBL: ENSMUSP00000148200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000211067] [ENSMUST00000211327]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003961
AA Change: D1185G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863
AA Change: D1185G

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085351
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210248
AA Change: D1025G

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210844
Predicted Effect possibly damaging
Transcript: ENSMUST00000211067
AA Change: D1185G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211098
Predicted Effect probably benign
Transcript: ENSMUST00000211327
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. Liprin family protein has been shown to localize phosphatase LAR to cell focal adhesions and may be involved in the molecular organization of presynaptic active zones. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Ppfia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ppfia3 APN 7 45360057 splice site probably null
IGL02086:Ppfia3 APN 7 45340572 unclassified probably benign
IGL02160:Ppfia3 APN 7 45360051 splice site probably benign
IGL02373:Ppfia3 APN 7 45358849 missense probably damaging 0.98
IGL02417:Ppfia3 APN 7 45341717 missense probably damaging 0.98
IGL02501:Ppfia3 APN 7 45354938 splice site probably benign
IGL02638:Ppfia3 APN 7 45356668 missense probably damaging 1.00
IGL03084:Ppfia3 APN 7 45340227 missense probably benign 0.00
R0207:Ppfia3 UTSW 7 45348534 missense probably damaging 1.00
R0962:Ppfia3 UTSW 7 45347722 splice site probably benign
R1086:Ppfia3 UTSW 7 45361758 missense probably damaging 1.00
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1566:Ppfia3 UTSW 7 45340688 missense probably damaging 1.00
R1677:Ppfia3 UTSW 7 45356666 missense probably benign 0.03
R1876:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.75
R2219:Ppfia3 UTSW 7 45354890 nonsense probably null
R2336:Ppfia3 UTSW 7 45356697 splice site probably null
R2843:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R2844:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R2846:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R4669:Ppfia3 UTSW 7 45352093 missense probably damaging 1.00
R4777:Ppfia3 UTSW 7 45341157 missense probably damaging 1.00
R4787:Ppfia3 UTSW 7 45340626 missense possibly damaging 0.89
R4994:Ppfia3 UTSW 7 45341118 missense probably damaging 1.00
R5042:Ppfia3 UTSW 7 45342341 missense probably damaging 1.00
R5821:Ppfia3 UTSW 7 45353616 missense probably damaging 0.96
R6116:Ppfia3 UTSW 7 45354703 missense probably damaging 1.00
R6868:Ppfia3 UTSW 7 45353612 missense probably damaging 1.00
R6920:Ppfia3 UTSW 7 45358807 missense possibly damaging 0.46
R6935:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.47
R6978:Ppfia3 UTSW 7 45346848 missense probably benign 0.02
R7017:Ppfia3 UTSW 7 45358800 missense probably benign
R7027:Ppfia3 UTSW 7 45354736 missense possibly damaging 0.80
R7078:Ppfia3 UTSW 7 45360595 missense probably damaging 1.00
R7256:Ppfia3 UTSW 7 45341743 missense probably benign 0.43
R7378:Ppfia3 UTSW 7 45361446 splice site probably null
R7570:Ppfia3 UTSW 7 45340748 critical splice acceptor site probably null
R7814:Ppfia3 UTSW 7 45352262 missense probably benign
R8298:Ppfia3 UTSW 7 45360194 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCATAGGAGTGAGAATGAGGTC -3'
(R):5'- ACTGCAGCCTGAAGGTAAGG -3'

Sequencing Primer
(F):5'- AGGTCACTTTCATTGAGGTCAGACAG -3'
(R):5'- TTCAAGACAGTCAGGGCTGCTTAG -3'
Posted On2018-06-06