Incidental Mutation 'R6539:Muc16'
ID520602
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18637325 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 5891 (T5891A)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: T5891A

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAGTCCTCTCTGAATCACCAGG -3'
(R):5'- TGCTTCTCCAGGTCAACTAGAG -3'

Sequencing Primer
(F):5'- CTCTCTGAATCACCAGGTAAAGTAGG -3'
(R):5'- ACTAGAGACCCCTGCCTTGATG -3'
Posted On2018-06-06