Incidental Mutation 'R6515:Hbb-bh1'
ID520603
Institutional Source Beutler Lab
Gene Symbol Hbb-bh1
Ensembl Gene ENSMUSG00000052217
Gene Namehemoglobin Z, beta-like embryonic chain
Synonymsbeta Hl globin, betaH1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103841637-103843164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103842767 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000064865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063957] [ENSMUST00000106866]
Predicted Effect probably damaging
Transcript: ENSMUST00000063957
AA Change: D80G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064865
Gene: ENSMUSG00000052217
AA Change: D80G

DomainStartEndE-ValueType
Pfam:Globin 8 112 4.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106866
SMART Domains Protein: ENSMUSP00000102479
Gene: ENSMUSG00000078621

DomainStartEndE-ValueType
Pfam:Globin 8 112 1.9e-25 PFAM
Meta Mutation Damage Score 0.6184 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The epsilon globin gene (HBE) is normally expressed in the embryonic yolk sac: two epsilon chains together with two zeta chains (an alpha-like globin) constitute the embryonic hemoglobin Hb Gower I; two epsilon chains together with two alpha chains form the embryonic Hb Gower II. Both of these embryonic hemoglobins are normally supplanted by fetal, and later, adult hemoglobin. The five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon - G-gamma - A-gamma - delta - beta-3' [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with disruptions in this gene are grossly normal and viable through adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Hbb-bh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Hbb-bh1 APN 7 103841817 missense probably benign 0.03
IGL02229:Hbb-bh1 APN 7 103842825 missense possibly damaging 0.77
IGL02251:Hbb-bh1 APN 7 103842810 nonsense probably null
R2913:Hbb-bh1 UTSW 7 103843047 missense possibly damaging 0.86
R5054:Hbb-bh1 UTSW 7 103841856 missense probably benign
R7286:Hbb-bh1 UTSW 7 103843031 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAACCTCTGTCAAGGCATTGC -3'
(R):5'- TTGTGCATGGCAGAAATTTCCAG -3'

Sequencing Primer
(F):5'- GCATTGCCAAGCACAGTCTC -3'
(R):5'- CATGGCAGAAATTTCCAGGGTTTC -3'
Posted On2018-06-06