Incidental Mutation 'R6515:Rbm34'
ID520609
Institutional Source Beutler Lab
Gene Symbol Rbm34
Ensembl Gene ENSMUSG00000033931
Gene NameRNA binding motif protein 34
Synonyms4930547K05Rik, D8Ertd233e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location126947172-126971071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126961932 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 217 (S217T)
Ref Sequence ENSEMBL: ENSMUSP00000048450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045994] [ENSMUST00000212618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045994
AA Change: S217T

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048450
Gene: ENSMUSG00000033931
AA Change: S217T

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 41 53 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 140 152 N/A INTRINSIC
RRM 190 280 5.33e-10 SMART
RRM 292 364 5.2e-22 SMART
internal_repeat_2 394 404 6.88e-5 PROSPERO
internal_repeat_2 401 411 6.88e-5 PROSPERO
low complexity region 423 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212583
Predicted Effect probably benign
Transcript: ENSMUST00000212618
Meta Mutation Damage Score 0.2910 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA-binding motif family of RNA recognition motif proteins. The encoded protein contains an RNA-binding domain made up of two RNA recognition motif subdomains referred to as RNA recognition motif-1 and RNA recognition motif-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Rbm34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Rbm34 APN 8 126969986 missense probably benign 0.10
IGL02505:Rbm34 APN 8 126949321 missense probably benign 0.08
IGL03166:Rbm34 APN 8 126970856 missense probably damaging 1.00
R0081:Rbm34 UTSW 8 126949484 missense probably damaging 0.99
R1186:Rbm34 UTSW 8 126965447 nonsense probably null
R1257:Rbm34 UTSW 8 126970893 missense possibly damaging 0.45
R1867:Rbm34 UTSW 8 126970881 missense probably benign 0.17
R1868:Rbm34 UTSW 8 126970881 missense probably benign 0.17
R4008:Rbm34 UTSW 8 126949287 missense probably benign 0.00
R4395:Rbm34 UTSW 8 126949381 missense probably benign 0.03
R4823:Rbm34 UTSW 8 126970905 missense probably benign 0.01
R4903:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R4964:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R4966:Rbm34 UTSW 8 126951337 missense possibly damaging 0.71
R5605:Rbm34 UTSW 8 126949419 missense probably benign 0.05
R5734:Rbm34 UTSW 8 126970130 critical splice acceptor site probably null
R8263:Rbm34 UTSW 8 126965389 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGTGAGAAACAGTCCCCTG -3'
(R):5'- CACACTTGATTCTGGAATGGCC -3'

Sequencing Primer
(F):5'- CTGCCTACTCTGACAGCAG -3'
(R):5'- CCTGGAACTCACTTTGTAGAACAGG -3'
Posted On2018-06-06