Incidental Mutation 'R6515:Tle6'
ID520615
Institutional Source Beutler Lab
Gene Symbol Tle6
Ensembl Gene ENSMUSG00000034758
Gene Nametransducin-like enhancer of split 6
Synonyms1810057E06Rik, Grg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R6515 (G1)
Quality Score136.008
Status Validated
Chromosome10
Chromosomal Location81590904-81601073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81591976 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 482 (H482Y)
Ref Sequence ENSEMBL: ENSMUSP00000117287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072020] [ENSMUST00000127546] [ENSMUST00000142948] [ENSMUST00000135211] [ENSMUST00000151858] [ENSMUST00000146916] [ENSMUST00000146358]
Predicted Effect probably damaging
Transcript: ENSMUST00000072020
AA Change: H492Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758
AA Change: H492Y

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124724
Predicted Effect probably benign
Transcript: ENSMUST00000124854
SMART Domains Protein: ENSMUSP00000118334
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Blast:WD40 6 44 9e-20 BLAST
WD40 46 85 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect probably benign
Transcript: ENSMUST00000131411
SMART Domains Protein: ENSMUSP00000114400
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
WD40 36 75 1.2e-2 SMART
WD40 76 116 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135008
Predicted Effect probably damaging
Transcript: ENSMUST00000142948
AA Change: H482Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758
AA Change: H482Y

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135211
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151858
SMART Domains Protein: ENSMUSP00000119945
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149721
Predicted Effect probably benign
Transcript: ENSMUST00000146916
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153812
Predicted Effect probably benign
Transcript: ENSMUST00000146358
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Groucho/ transducin-like Enhancer of split family of transcriptional co-repressors. The encoded protein is a component of the mammalian subcortical maternal complex, which is required for preimplantation development. In mouse, knock out of this gene results in cleavage-stage embryonic arrest resulting from defective cytoplasmic F-actin meshwork formation and asymmetric cell division. In human, an allelic variant in this gene is associated with preimplantation embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Tle6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tle6 APN 10 81594458 missense probably damaging 1.00
IGL02151:Tle6 APN 10 81598640 missense probably benign 0.01
IGL02724:Tle6 APN 10 81600064 nonsense probably null
R0420:Tle6 UTSW 10 81595311 unclassified probably benign
R0423:Tle6 UTSW 10 81598623 missense possibly damaging 0.95
R0589:Tle6 UTSW 10 81595419 unclassified probably benign
R0605:Tle6 UTSW 10 81594346 missense probably damaging 0.99
R1554:Tle6 UTSW 10 81595385 missense probably benign 0.05
R1860:Tle6 UTSW 10 81594329 missense probably damaging 1.00
R1863:Tle6 UTSW 10 81591921 missense possibly damaging 0.91
R1952:Tle6 UTSW 10 81595485 missense possibly damaging 0.82
R2139:Tle6 UTSW 10 81594034 missense probably damaging 0.99
R2337:Tle6 UTSW 10 81592656 unclassified probably null
R2849:Tle6 UTSW 10 81594401 missense probably damaging 1.00
R3158:Tle6 UTSW 10 81595204 splice site probably null
R3777:Tle6 UTSW 10 81596153 missense probably benign 0.23
R3778:Tle6 UTSW 10 81596153 missense probably benign 0.23
R4085:Tle6 UTSW 10 81594515 unclassified probably null
R5058:Tle6 UTSW 10 81594238 missense possibly damaging 0.93
R5058:Tle6 UTSW 10 81595957 missense probably damaging 1.00
R5183:Tle6 UTSW 10 81592801 missense probably damaging 0.97
R6225:Tle6 UTSW 10 81592766 missense probably damaging 1.00
R6331:Tle6 UTSW 10 81595239 missense probably benign 0.00
R6514:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6517:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R7145:Tle6 UTSW 10 81600076 missense possibly damaging 0.66
R8070:Tle6 UTSW 10 81598642 missense possibly damaging 0.79
R8085:Tle6 UTSW 10 81595958 missense probably damaging 1.00
R8194:Tle6 UTSW 10 81591054 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAATAGCAGGGTCCTCTGAGAG -3'
(R):5'- CCTCACAGAAGGAAGGTGTG -3'

Sequencing Primer
(F):5'- GTCCTGGAACTCTGTACACCAG -3'
(R):5'- AGACACAGTCGGGCCACAG -3'
Posted On2018-06-06