Incidental Mutation 'R6539:Tbcd'
ID520618
Institutional Source Beutler Lab
Gene Symbol Tbcd
Ensembl Gene ENSMUSG00000039230
Gene Nametubulin-specific chaperone d
Synonyms2310057L06Rik, A030005L14Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029878.3; MGI:1919686

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location121451949-121617164 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 121556987 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103013]
Predicted Effect probably null
Transcript: ENSMUST00000103013
SMART Domains Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
SCOP:d1b3ua_ 357 742 4e-20 SMART
Pfam:TFCD_C 900 1090 1.4e-74 PFAM
low complexity region 1113 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125167
SMART Domains Protein: ENSMUSP00000124735
Gene: ENSMUSG00000039230

DomainStartEndE-ValueType
low complexity region 36 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147560
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Tbcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Tbcd APN 11 121575321 missense probably damaging 0.96
IGL00795:Tbcd APN 11 121616932 missense probably benign
IGL00802:Tbcd APN 11 121608610 missense possibly damaging 0.55
IGL01286:Tbcd APN 11 121493893 critical splice donor site probably null
IGL01325:Tbcd APN 11 121540993 missense probably damaging 0.99
IGL01348:Tbcd APN 11 121497076 missense probably benign
IGL01432:Tbcd APN 11 121475680 splice site probably benign
IGL01577:Tbcd APN 11 121497012 missense probably damaging 1.00
IGL01660:Tbcd APN 11 121605327 missense probably benign 0.01
IGL01865:Tbcd APN 11 121590380 missense possibly damaging 0.81
IGL02260:Tbcd APN 11 121603278 missense probably damaging 1.00
IGL02492:Tbcd APN 11 121497134 missense probably benign 0.06
IGL02620:Tbcd APN 11 121461255 missense probably damaging 1.00
IGL02950:Tbcd APN 11 121603709 missense probably damaging 0.99
R6859_Tbcd_818 UTSW 11 121497111 missense possibly damaging 0.81
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0077:Tbcd UTSW 11 121594274 missense probably benign 0.00
R0349:Tbcd UTSW 11 121602983 splice site probably null
R0865:Tbcd UTSW 11 121602989 missense possibly damaging 0.88
R1203:Tbcd UTSW 11 121475625 missense probably benign 0.00
R1221:Tbcd UTSW 11 121497083 missense probably benign 0.00
R1549:Tbcd UTSW 11 121560753 missense probably benign
R1586:Tbcd UTSW 11 121497060 missense probably benign 0.13
R1671:Tbcd UTSW 11 121597294 missense probably benign 0.00
R2048:Tbcd UTSW 11 121540936 missense probably damaging 1.00
R2051:Tbcd UTSW 11 121453670 missense probably damaging 1.00
R2124:Tbcd UTSW 11 121603320 missense probably damaging 1.00
R2151:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R2153:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R3120:Tbcd UTSW 11 121608648 missense probably damaging 0.97
R4108:Tbcd UTSW 11 121493811 missense probably benign 0.00
R4244:Tbcd UTSW 11 121594281 missense probably damaging 1.00
R4587:Tbcd UTSW 11 121605271 missense possibly damaging 0.75
R4684:Tbcd UTSW 11 121493771 missense probably damaging 1.00
R4837:Tbcd UTSW 11 121582785 critical splice donor site probably null
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4960:Tbcd UTSW 11 121573855 missense probably benign 0.03
R5157:Tbcd UTSW 11 121610027 missense probably benign 0.14
R5166:Tbcd UTSW 11 121609390 missense possibly damaging 0.87
R5403:Tbcd UTSW 11 121560743 missense probably damaging 0.99
R5406:Tbcd UTSW 11 121452101 missense probably benign
R5509:Tbcd UTSW 11 121602012 missense probably benign 0.00
R5767:Tbcd UTSW 11 121592692 missense probably benign 0.00
R5923:Tbcd UTSW 11 121580152 missense probably benign
R5966:Tbcd UTSW 11 121601911 intron probably benign
R6330:Tbcd UTSW 11 121497086 missense probably benign
R6852:Tbcd UTSW 11 121609380 missense probably benign 0.36
R6859:Tbcd UTSW 11 121497111 missense possibly damaging 0.81
R7348:Tbcd UTSW 11 121594311 missense probably benign 0.22
R7479:Tbcd UTSW 11 121492605 critical splice donor site probably null
R7679:Tbcd UTSW 11 121603708 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGTCAGCCAACAAAGAGG -3'
(R):5'- AAACACTCTCACACGGGGTTTC -3'

Sequencing Primer
(F):5'- TGGTGTTTAGCAGAGGCA -3'
(R):5'- TTTCCTGAAAGACACGTGGGACTC -3'
Posted On2018-06-06