Incidental Mutation 'R6515:Cdk4'
ID520619
Institutional Source Beutler Lab
Gene Symbol Cdk4
Ensembl Gene ENSMUSG00000006728
Gene Namecyclin-dependent kinase 4
SynonymsCrk3, p34/cdk4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127063534-127067920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127066183 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 256 (P256S)
Ref Sequence ENSEMBL: ENSMUSP00000117234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000060991] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]
Predicted Effect probably null
Transcript: ENSMUST00000006911
AA Change: P256S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728
AA Change: P256S

DomainStartEndE-ValueType
S_TKc 6 295 9.2e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060991
SMART Domains Protein: ENSMUSP00000057751
Gene: ENSMUSG00000006736

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 200 1.2e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120226
SMART Domains Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 103 6e-10 PFAM
low complexity region 121 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123456
Predicted Effect probably null
Transcript: ENSMUST00000125682
AA Change: P256S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728
AA Change: P256S

DomainStartEndE-ValueType
S_TKc 6 261 5.19e-72 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133115
SMART Domains Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
S_TKc 6 250 1.55e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140254
Predicted Effect probably benign
Transcript: ENSMUST00000142558
SMART Domains Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 74 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218603
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have small size, insulin-deficient diabetes, sterility in females; near-sterility in males and impaired prolactin secretion due to hypoplastic pituitary development. Locomotor and endocrine gland defects are seen with some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Cdk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Cdk4 APN 10 127064297 missense probably damaging 1.00
IGL01326:Cdk4 APN 10 127064623 missense possibly damaging 0.95
R0140:Cdk4 UTSW 10 127064345 missense probably damaging 1.00
R0799:Cdk4 UTSW 10 127064994 missense probably damaging 0.98
R1437:Cdk4 UTSW 10 127064689 missense probably damaging 1.00
R1575:Cdk4 UTSW 10 127064651 missense probably damaging 1.00
R1656:Cdk4 UTSW 10 127064980 missense probably benign 0.00
R1761:Cdk4 UTSW 10 127064677 splice site probably null
R2567:Cdk4 UTSW 10 127064276 missense probably benign 0.01
R4679:Cdk4 UTSW 10 127064911 missense possibly damaging 0.93
R4790:Cdk4 UTSW 10 127064701 missense probably damaging 1.00
R4897:Cdk4 UTSW 10 127064575 intron probably benign
R4946:Cdk4 UTSW 10 127064890 splice site probably null
R5755:Cdk4 UTSW 10 127064722 critical splice donor site probably null
R6868:Cdk4 UTSW 10 127065001 missense probably benign 0.43
R7488:Cdk4 UTSW 10 127064237 start codon destroyed probably null 0.26
R7748:Cdk4 UTSW 10 127064429 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CCAGTTGGGGAAAATCTTTGAG -3'
(R):5'- TCATTGGAGACTCTGTCAGCG -3'

Sequencing Primer
(F):5'- CCTAACAGAGTTGTCCTGTC -3'
(R):5'- ACATGGTGGCTTACAACCATCTG -3'
Posted On2018-06-06