Incidental Mutation 'R6515:Spop'
ID520621
Institutional Source Beutler Lab
Gene Symbol Spop
Ensembl Gene ENSMUSG00000057522
Gene Namespeckle-type POZ protein
SynonymsPcif1, TEF2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95414080-95493406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95485935 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 271 (D271E)
Ref Sequence ENSEMBL: ENSMUSP00000103352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107722] [ENSMUST00000107724]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107722
AA Change: D271E

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103350
Gene: ENSMUSG00000057522
AA Change: D271E

DomainStartEndE-ValueType
MATH 36 142 4.41e-15 SMART
BTB 200 297 5.01e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107724
AA Change: D271E

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103352
Gene: ENSMUSG00000057522
AA Change: D271E

DomainStartEndE-ValueType
MATH 36 142 4.41e-15 SMART
BTB 200 297 5.01e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150922
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased beta cell area and lethality between E18.5 and P1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Spop
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Spop APN 11 95485921 missense possibly damaging 0.47
IGL02797:Spop APN 11 95482083 missense probably damaging 1.00
R0885:Spop UTSW 11 95470627 missense probably benign 0.00
R1961:Spop UTSW 11 95491711 missense possibly damaging 0.56
R5546:Spop UTSW 11 95485843 missense probably damaging 1.00
R5729:Spop UTSW 11 95485849 missense possibly damaging 0.53
R5757:Spop UTSW 11 95490382 missense probably damaging 1.00
R6207:Spop UTSW 11 95471237 missense possibly damaging 0.75
R6996:Spop UTSW 11 95471310 missense possibly damaging 0.75
R7414:Spop UTSW 11 95474508 missense probably damaging 1.00
R7468:Spop UTSW 11 95485901 missense probably damaging 0.99
R7922:Spop UTSW 11 95471328 missense probably damaging 0.98
R8029:Spop UTSW 11 95474367 missense probably benign 0.14
R8208:Spop UTSW 11 95491824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCTACCCATGGTGTTAGG -3'
(R):5'- CAGGACACTTTTAGTACCAAACG -3'

Sequencing Primer
(F):5'- CCATGGTGTTAGGTTTAACTCACAC -3'
(R):5'- GTACCAAACGTTACTACTGTGTTAG -3'
Posted On2018-06-06