Mutagenetix > Incidental Mutations

Incidental Mutation 'R6539:Nek10'

520630

Institutional Source

Beutler Lab

Gene Symbol

Nek10

Ensembl Gene

ENSMUSG00000042567

Gene Name

NIMA (never in mitosis gene a)- related kinase 10

Synonyms

LOC238944

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6539 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14803415-15012059 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14860789 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 475 (V475D)

Ref Sequence

ENSEMBL: ENSMUSP00000153142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000063220

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112630
AA Change: V475D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: V475D

Domain	Start	End	E-Value	Type
ARM	197	238	8.23e1	SMART
ARM	278	320	5.18e0	SMART
low complexity region	387	400	N/A	INTRINSIC
ARM	401	448	7.09e1	SMART
S_TKc	519	791	2.36e-75	SMART
low complexity region	799	811	N/A	INTRINSIC
low complexity region	839	863	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112631
AA Change: V475D

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: V475D

Domain	Start	End	E-Value	Type
ARM	197	238	8.23e1	SMART
ARM	278	320	5.18e0	SMART
low complexity region	387	400	N/A	INTRINSIC
ARM	401	448	7.09e1	SMART
S_TKc	519	791	2.36e-75	SMART
low complexity region	799	811	N/A	INTRINSIC
low complexity region	839	863	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134866

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224491
AA Change: V475D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	A	G	10: 77,984,488	T231A	probably benign	Het
Adam5	G	A	8: 24,782,600	A513V	possibly damaging	Het
Ano8	T	C	8: 71,484,483	D147G	probably damaging	Het
Apba1	A	G	19: 23,936,560	D649G	probably damaging	Het
Atp6v0d1	T	C	8: 105,524,974	I329V	probably benign	Het
Card6	T	A	15: 5,105,391	N110I	probably damaging	Het
Chn2	T	A	6: 54,173,461		probably null	Het
Cyp46a1	G	A	12: 108,353,157		probably null	Het
Daam2	T	A	17: 49,469,711	H782L	probably damaging	Het
Defa26	A	G	8: 21,618,246	I22V	possibly damaging	Het
Dlk1	A	G	12: 109,460,319	M278V	probably benign	Het
Dync2h1	T	C	9: 7,159,478		probably null	Het
Ehmt1	T	A	2: 24,804,767	H1056L	probably damaging	Het
Ephb3	G	A	16: 21,221,468	D527N	probably benign	Het
Fam46a	T	C	9: 85,326,561	I70V	possibly damaging	Het
Flt1	T	C	5: 147,578,376	K1079E	probably benign	Het
Fndc3b	C	T	3: 27,538,057	G231R	probably benign	Het
Gm4924	T	A	10: 82,378,524		probably benign	Het
Ifrd1	G	A	12: 40,203,435	A426V	probably damaging	Het
Ift140	T	C	17: 25,094,669	L1358P	possibly damaging	Het
Igkv5-37	A	T	6: 69,963,816	S16T	probably benign	Het
Map3k9	A	G	12: 81,732,192	L449P	probably damaging	Het
Mdm1	T	C	10: 118,150,958		probably null	Het
Mmrn1	A	T	6: 60,987,184	T1056S	probably benign	Het
Mroh2b	C	T	15: 4,905,574	H164Y	probably damaging	Het
Muc16	T	C	9: 18,637,325	T5891A	probably benign	Het
Nagpa	T	C	16: 5,203,701	E62G	possibly damaging	Het
Olfr1188	T	C	2: 88,559,520	F6S	probably damaging	Het
Olfr194	A	C	16: 59,119,751	S106R	probably damaging	Het
Pan3	T	C	5: 147,450,653	I144T	possibly damaging	Het
Parvg	T	A	15: 84,341,340	D349E	probably damaging	Het
Pitpna	A	G	11: 75,598,301	Y58C	probably damaging	Het
Ppp4r3b	T	A	11: 29,218,503	D73E	probably benign	Het
Preb	A	G	5: 30,956,076	V338A	probably benign	Het
Sec23a	T	C	12: 58,985,212	T411A	probably benign	Het
Smc6	A	G	12: 11,297,010		probably null	Het
Stxbp5l	A	G	16: 37,129,815	M1056T	probably damaging	Het
Tbcd	T	A	11: 121,556,987		probably null	Het
Tpx2	G	T	2: 152,876,598	E174*	probably null	Het
Trpc4ap	G	T	2: 155,636,258	P663T	probably benign	Het
Unc5cl	G	A	17: 48,465,017	G441D	probably damaging	Het
Xrcc2	G	T	5: 25,692,532	R140S	probably benign	Het
Zfc3h1	G	A	10: 115,412,002	E1037K	probably benign	Het
Zfhx4	A	T	3: 5,244,108	Q798L	probably damaging	Het
Zfp94	G	A	7: 24,303,291	T236M	probably damaging	Het

Other mutations in Nek10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Nek10	APN	14	14850957	missense	probably damaging	0.99
IGL02067:Nek10	APN	14	14861639	missense	probably benign	0.12
IGL02361:Nek10	APN	14	14843856	missense	probably damaging	1.00
IGL02687:Nek10	APN	14	14840570	missense	probably damaging	1.00
IGL02929:Nek10	APN	14	14821119	missense	possibly damaging	0.82
IGL03229:Nek10	APN	14	14986686	missense	probably benign	0.10
P0041:Nek10	UTSW	14	14861603	missense	probably benign	0.01
R0007:Nek10	UTSW	14	14840574	missense	probably benign	0.10
R0007:Nek10	UTSW	14	14840574	missense	probably benign	0.10
R0142:Nek10	UTSW	14	14861560	missense	possibly damaging	0.96
R0433:Nek10	UTSW	14	14860927	missense	probably benign	0.32
R0633:Nek10	UTSW	14	14857782	critical splice acceptor site	probably null
R1087:Nek10	UTSW	14	14827059	missense	possibly damaging	0.59
R1184:Nek10	UTSW	14	14931325	splice site	probably benign
R1250:Nek10	UTSW	14	14853887	missense	probably damaging	1.00
R1371:Nek10	UTSW	14	14850983	missense	probably damaging	0.98
R1506:Nek10	UTSW	14	14999078	splice site	probably benign
R1829:Nek10	UTSW	14	14863454	critical splice acceptor site	probably null
R1831:Nek10	UTSW	14	14842789	missense	probably benign
R1833:Nek10	UTSW	14	14842789	missense	probably benign
R1990:Nek10	UTSW	14	14860764	missense	probably benign
R1997:Nek10	UTSW	14	14827003	missense	probably benign	0.09
R2011:Nek10	UTSW	14	14885122	missense	probably damaging	1.00
R2158:Nek10	UTSW	14	14885047	splice site	probably null
R2288:Nek10	UTSW	14	14853956	nonsense	probably null
R2568:Nek10	UTSW	14	14999112	missense	possibly damaging	0.89
R2907:Nek10	UTSW	14	14980613	missense	possibly damaging	0.81
R2965:Nek10	UTSW	14	14836202	missense	probably damaging	1.00
R3922:Nek10	UTSW	14	14861585	missense	possibly damaging	0.88
R4032:Nek10	UTSW	14	14853877	splice site	probably null
R4700:Nek10	UTSW	14	14842841	missense	possibly damaging	0.69
R4742:Nek10	UTSW	14	14861624	missense	probably null	0.03
R4785:Nek10	UTSW	14	14855714	missense	probably benign
R4890:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4891:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4920:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4924:Nek10	UTSW	14	14846594	splice site	probably null
R4928:Nek10	UTSW	14	14930577	missense	probably damaging	1.00
R4948:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4952:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4953:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R5092:Nek10	UTSW	14	14820851	missense	possibly damaging	0.81
R5097:Nek10	UTSW	14	14857851	missense	probably benign	0.00
R5593:Nek10	UTSW	14	14980544	nonsense	probably null
R5696:Nek10	UTSW	14	14860736	splice site	probably null
R5813:Nek10	UTSW	14	14986704	missense	probably benign	0.01
R5829:Nek10	UTSW	14	14865404	missense	probably damaging	1.00
R5872:Nek10	UTSW	14	14850896	missense	probably benign	0.06
R5939:Nek10	UTSW	14	14931290	missense	possibly damaging	0.58
R6025:Nek10	UTSW	14	14865633	missense	probably benign	0.41
R6235:Nek10	UTSW	14	14821113	nonsense	probably null
R6542:Nek10	UTSW	14	14999108	missense	probably benign	0.44
R6561:Nek10	UTSW	14	14828448	missense	possibly damaging	0.48
R6659:Nek10	UTSW	14	14861684	missense	probably benign	0.29
R7039:Nek10	UTSW	14	14826946	missense	possibly damaging	0.63
R7039:Nek10	UTSW	14	14986700	missense	probably damaging	0.99
R7102:Nek10	UTSW	14	14828517	missense	probably damaging	1.00
R7185:Nek10	UTSW	14	14846621	missense	probably benign	0.03
R7198:Nek10	UTSW	14	14850947	missense	probably damaging	0.99
R7202:Nek10	UTSW	14	14836171	missense	probably benign	0.01
R7251:Nek10	UTSW	14	14853965	missense	probably benign
R7345:Nek10	UTSW	14	14955503	missense	probably benign
R7590:Nek10	UTSW	14	15006693	makesense	probably null
R7593:Nek10	UTSW	14	14826955	missense	probably benign	0.04
R7616:Nek10	UTSW	14	14937759	missense	probably benign	0.27
R7635:Nek10	UTSW	14	14850932	missense	probably benign	0.01
R7817:Nek10	UTSW	14	15001017	missense	probably benign	0.00
R7826:Nek10	UTSW	14	14860846	splice site	probably null
R7986:Nek10	UTSW	14	15001020	missense	probably benign	0.17
R8765:Nek10	UTSW	14	14999104	missense	probably damaging	0.97
Z1177:Nek10	UTSW	14	14853948	missense	probably benign	0.00
Z1177:Nek10	UTSW	14	15001157	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTCTGCTGATTGCCTAATGAAG -3'
(R):5'- TGGTCCAACACAGCATAGTC -3'

Sequencing Primer
(F):5'- CTAATGAAGTTAGGTTTGTTCGTAGG -3'
(R):5'- ACCTATGTACTTCAAGGGCG -3'

Posted On

2018-06-06