Incidental Mutation 'R6539:Mroh2b'
ID520632
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4905574 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 164 (H164Y)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: H164Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: H164Y

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226277
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 intron probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGACAGACTACCTCCTAGTAAGAG -3'
(R):5'- ACCAAACTCTAAAACTGGTTTGACC -3'

Sequencing Primer
(F):5'- GTCTGTGCTTTCTTTTAGAAA -3'
(R):5'- CCAGTATGGGGATTTACAACTTGAGC -3'
Posted On2018-06-06