Incidental Mutation 'R6515:Cabyr'
ID520637
Institutional Source Beutler Lab
Gene Symbol Cabyr
Ensembl Gene ENSMUSG00000024430
Gene Namecalcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2)
SynonymsFSP-2, 4933421A18Rik, CBP86, 1700016C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location12741324-12755146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12754283 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 324 (S324G)
Ref Sequence ENSEMBL: ENSMUSP00000113131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119108] [ENSMUST00000119512] [ENSMUST00000121018] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000150758] [ENSMUST00000191078] [ENSMUST00000186263]
Predicted Effect probably benign
Transcript: ENSMUST00000074352
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080415
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115857
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117361
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119512
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121018
AA Change: S324G

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430
AA Change: S324G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121774
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121888
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150758
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191078
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186263
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout affects sperm flagellum morphology, resulting in reduced sperm motility. These mutant males are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Cabyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Cabyr APN 18 12744610 missense probably damaging 0.99
R0547:Cabyr UTSW 18 12751016 missense probably benign 0.07
R0571:Cabyr UTSW 18 12750852 missense probably damaging 1.00
R1556:Cabyr UTSW 18 12744780 missense probably damaging 1.00
R3084:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3085:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3086:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3824:Cabyr UTSW 18 12751690 missense probably benign 0.04
R3898:Cabyr UTSW 18 12751523 missense probably benign 0.00
R4869:Cabyr UTSW 18 12751818 makesense probably null
R4933:Cabyr UTSW 18 12744492 splice site probably benign
R5036:Cabyr UTSW 18 12751246 missense probably damaging 1.00
R5482:Cabyr UTSW 18 12751439 missense possibly damaging 0.95
R5932:Cabyr UTSW 18 12754350 missense probably damaging 1.00
R6556:Cabyr UTSW 18 12751016 missense probably benign 0.07
R6852:Cabyr UTSW 18 12754097 missense probably benign 0.35
R6907:Cabyr UTSW 18 12750912 missense probably benign 0.05
R7193:Cabyr UTSW 18 12751758 missense probably damaging 1.00
R7565:Cabyr UTSW 18 12744599 missense possibly damaging 0.50
R7777:Cabyr UTSW 18 12744771 missense probably damaging 1.00
R7941:Cabyr UTSW 18 12744768 missense probably damaging 1.00
R8243:Cabyr UTSW 18 12750702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCAAATGTTCAGGAAGC -3'
(R):5'- AGGCTCAAGTGTGTCACAGC -3'

Sequencing Primer
(F):5'- CGCAGGATTGGAACCCTCTTC -3'
(R):5'- AGTGTGTCACAGCCCACATG -3'
Posted On2018-06-06