Incidental Mutation 'R6539:Ephb3'
ID520640
Institutional Source Beutler Lab
Gene Symbol Ephb3
Ensembl Gene ENSMUSG00000005958
Gene NameEph receptor B3
SynonymsTyro6, HEK2, MDK5, Sek4, Etk2, Cek10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location21204755-21223305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21221468 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 527 (D527N)
Ref Sequence ENSEMBL: ENSMUSP00000124375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]
Predicted Effect probably benign
Transcript: ENSMUST00000006112
AA Change: D781N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: D781N

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
EPH_lbd 31 204 6.47e-126 SMART
Pfam:GCC2_GCC3 269 312 5.8e-9 PFAM
FN3 332 430 8.43e-9 SMART
FN3 448 527 2.72e-12 SMART
Pfam:EphA2_TM 555 625 1e-24 PFAM
TyrKc 628 887 1.35e-134 SMART
SAM 917 984 3.88e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160053
Predicted Effect probably benign
Transcript: ENSMUST00000161063
AA Change: D527N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Ephb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ephb3 APN 16 21220415 splice site probably null
IGL00966:Ephb3 APN 16 21217294 missense probably benign 0.00
IGL02166:Ephb3 APN 16 21220749 missense probably damaging 1.00
IGL02245:Ephb3 APN 16 21221424 missense probably benign 0.04
IGL02321:Ephb3 APN 16 21214389 missense probably damaging 1.00
IGL02337:Ephb3 APN 16 21221503 splice site probably null
IGL02507:Ephb3 APN 16 21220639 splice site probably benign
IGL02755:Ephb3 APN 16 21221698 missense probably damaging 1.00
IGL02806:Ephb3 APN 16 21222281 missense probably benign 0.02
PIT4362001:Ephb3 UTSW 16 21220857 missense probably damaging 1.00
R0026:Ephb3 UTSW 16 21214917 missense probably damaging 1.00
R0194:Ephb3 UTSW 16 21218109 missense probably benign 0.01
R0196:Ephb3 UTSW 16 21218054 missense probably damaging 1.00
R0230:Ephb3 UTSW 16 21220775 missense probably damaging 1.00
R0828:Ephb3 UTSW 16 21219034 unclassified probably benign
R1126:Ephb3 UTSW 16 21222476 missense possibly damaging 0.87
R1460:Ephb3 UTSW 16 21218922 missense probably benign
R1592:Ephb3 UTSW 16 21221700 missense probably damaging 1.00
R1632:Ephb3 UTSW 16 21212937 missense probably benign 0.00
R1694:Ephb3 UTSW 16 21221745 missense probably damaging 1.00
R1719:Ephb3 UTSW 16 21220650 missense probably damaging 1.00
R1777:Ephb3 UTSW 16 21217235 missense probably damaging 0.99
R1928:Ephb3 UTSW 16 21222295 missense possibly damaging 0.86
R1956:Ephb3 UTSW 16 21221382 missense probably damaging 1.00
R2378:Ephb3 UTSW 16 21218243 missense probably benign
R3408:Ephb3 UTSW 16 21219504 missense probably damaging 0.99
R4027:Ephb3 UTSW 16 21221697 missense probably damaging 1.00
R4429:Ephb3 UTSW 16 21214463 missense probably damaging 1.00
R4655:Ephb3 UTSW 16 21222208 missense probably damaging 0.98
R4826:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4828:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4960:Ephb3 UTSW 16 21220495 missense probably benign 0.09
R5057:Ephb3 UTSW 16 21220447 missense probably damaging 1.00
R5090:Ephb3 UTSW 16 21214487 missense probably damaging 1.00
R5396:Ephb3 UTSW 16 21219105 missense possibly damaging 0.91
R5540:Ephb3 UTSW 16 21220860 missense probably damaging 1.00
R5628:Ephb3 UTSW 16 21218119 missense probably damaging 1.00
R5666:Ephb3 UTSW 16 21222491 missense probably benign 0.08
R5838:Ephb3 UTSW 16 21221687 missense probably damaging 1.00
R5866:Ephb3 UTSW 16 21211379 intron probably benign
R6017:Ephb3 UTSW 16 21222031 missense probably damaging 1.00
R6020:Ephb3 UTSW 16 21222013 missense probably damaging 0.99
R6510:Ephb3 UTSW 16 21218111 missense probably damaging 0.98
R6591:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R6691:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R7101:Ephb3 UTSW 16 21218518 missense possibly damaging 0.86
R7111:Ephb3 UTSW 16 21218827 nonsense probably null
R7236:Ephb3 UTSW 16 21214481 missense probably damaging 1.00
R7307:Ephb3 UTSW 16 21222226 missense probably benign 0.04
R7410:Ephb3 UTSW 16 21221408 missense possibly damaging 0.75
R7413:Ephb3 UTSW 16 21214707 missense probably damaging 1.00
R7452:Ephb3 UTSW 16 21217357 splice site probably null
R7944:Ephb3 UTSW 16 21221684 missense probably damaging 1.00
R7945:Ephb3 UTSW 16 21221684 missense probably damaging 1.00
Z1176:Ephb3 UTSW 16 21218036 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TTCACGGTCATCCAGCTTGTG -3'
(R):5'- ACATCGCTGGCAGACGTAAAC -3'

Sequencing Primer
(F):5'- CCAGCTTGTGGGCATGTTAC -3'
(R):5'- TGGCAGACGTAAACTTCCG -3'
Posted On2018-06-06