Mutagenetix > Incidental Mutations

Incidental Mutation 'R6539:Ephb3'

520640

Institutional Source

Beutler Lab

Gene Symbol

Ephb3

Ensembl Gene

ENSMUSG00000005958

Gene Name

Eph receptor B3

Synonyms

Tyro6, HEK2, MDK5, Sek4, Etk2, Cek10

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.901) question?

Stock #

R6539 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21204755-21223305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21221468 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 527 (D527N)

Ref Sequence

ENSEMBL: ENSMUSP00000124375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]

Predicted Effect

probably benign
Transcript: ENSMUST00000006112
AA Change: D781N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: D781N

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
EPH_lbd	31	204	6.47e-126	SMART
Pfam:GCC2_GCC3	269	312	5.8e-9	PFAM
FN3	332	430	8.43e-9	SMART
FN3	448	527	2.72e-12	SMART
Pfam:EphA2_TM	555	625	1e-24	PFAM
TyrKc	628	887	1.35e-134	SMART
SAM	917	984	3.88e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160053

Predicted Effect

probably benign
Transcript: ENSMUST00000161063
AA Change: D527N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	A	G	10: 77,984,488	T231A	probably benign	Het
Adam5	G	A	8: 24,782,600	A513V	possibly damaging	Het
Ano8	T	C	8: 71,484,483	D147G	probably damaging	Het
Apba1	A	G	19: 23,936,560	D649G	probably damaging	Het
Atp6v0d1	T	C	8: 105,524,974	I329V	probably benign	Het
Card6	T	A	15: 5,105,391	N110I	probably damaging	Het
Chn2	T	A	6: 54,173,461		probably null	Het
Cyp46a1	G	A	12: 108,353,157		probably null	Het
Daam2	T	A	17: 49,469,711	H782L	probably damaging	Het
Defa26	A	G	8: 21,618,246	I22V	possibly damaging	Het
Dlk1	A	G	12: 109,460,319	M278V	probably benign	Het
Dync2h1	T	C	9: 7,159,478		probably null	Het
Ehmt1	T	A	2: 24,804,767	H1056L	probably damaging	Het
Fam46a	T	C	9: 85,326,561	I70V	possibly damaging	Het
Flt1	T	C	5: 147,578,376	K1079E	probably benign	Het
Fndc3b	C	T	3: 27,538,057	G231R	probably benign	Het
Gm4924	T	A	10: 82,378,524		probably benign	Het
Ifrd1	G	A	12: 40,203,435	A426V	probably damaging	Het
Ift140	T	C	17: 25,094,669	L1358P	possibly damaging	Het
Igkv5-37	A	T	6: 69,963,816	S16T	probably benign	Het
Map3k9	A	G	12: 81,732,192	L449P	probably damaging	Het
Mdm1	T	C	10: 118,150,958		probably null	Het
Mmrn1	A	T	6: 60,987,184	T1056S	probably benign	Het
Mroh2b	C	T	15: 4,905,574	H164Y	probably damaging	Het
Muc16	T	C	9: 18,637,325	T5891A	probably benign	Het
Nagpa	T	C	16: 5,203,701	E62G	possibly damaging	Het
Nek10	T	A	14: 14,860,789	V475D	possibly damaging	Het
Olfr1188	T	C	2: 88,559,520	F6S	probably damaging	Het
Olfr194	A	C	16: 59,119,751	S106R	probably damaging	Het
Pan3	T	C	5: 147,450,653	I144T	possibly damaging	Het
Parvg	T	A	15: 84,341,340	D349E	probably damaging	Het
Pitpna	A	G	11: 75,598,301	Y58C	probably damaging	Het
Ppp4r3b	T	A	11: 29,218,503	D73E	probably benign	Het
Preb	A	G	5: 30,956,076	V338A	probably benign	Het
Sec23a	T	C	12: 58,985,212	T411A	probably benign	Het
Smc6	A	G	12: 11,297,010		probably null	Het
Stxbp5l	A	G	16: 37,129,815	M1056T	probably damaging	Het
Tbcd	T	A	11: 121,556,987		probably null	Het
Tpx2	G	T	2: 152,876,598	E174*	probably null	Het
Trpc4ap	G	T	2: 155,636,258	P663T	probably benign	Het
Unc5cl	G	A	17: 48,465,017	G441D	probably damaging	Het
Xrcc2	G	T	5: 25,692,532	R140S	probably benign	Het
Zfc3h1	G	A	10: 115,412,002	E1037K	probably benign	Het
Zfhx4	A	T	3: 5,244,108	Q798L	probably damaging	Het
Zfp94	G	A	7: 24,303,291	T236M	probably damaging	Het

Other mutations in Ephb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ephb3	APN	16	21220415	splice site	probably null
IGL00966:Ephb3	APN	16	21217294	missense	probably benign	0.00
IGL02166:Ephb3	APN	16	21220749	missense	probably damaging	1.00
IGL02245:Ephb3	APN	16	21221424	missense	probably benign	0.04
IGL02321:Ephb3	APN	16	21214389	missense	probably damaging	1.00
IGL02337:Ephb3	APN	16	21221503	splice site	probably null
IGL02507:Ephb3	APN	16	21220639	splice site	probably benign
IGL02755:Ephb3	APN	16	21221698	missense	probably damaging	1.00
IGL02806:Ephb3	APN	16	21222281	missense	probably benign	0.02
PIT4362001:Ephb3	UTSW	16	21220857	missense	probably damaging	1.00
R0026:Ephb3	UTSW	16	21214917	missense	probably damaging	1.00
R0194:Ephb3	UTSW	16	21218109	missense	probably benign	0.01
R0196:Ephb3	UTSW	16	21218054	missense	probably damaging	1.00
R0230:Ephb3	UTSW	16	21220775	missense	probably damaging	1.00
R0828:Ephb3	UTSW	16	21219034	unclassified	probably benign
R1126:Ephb3	UTSW	16	21222476	missense	possibly damaging	0.87
R1460:Ephb3	UTSW	16	21218922	missense	probably benign
R1592:Ephb3	UTSW	16	21221700	missense	probably damaging	1.00
R1632:Ephb3	UTSW	16	21212937	missense	probably benign	0.00
R1694:Ephb3	UTSW	16	21221745	missense	probably damaging	1.00
R1719:Ephb3	UTSW	16	21220650	missense	probably damaging	1.00
R1777:Ephb3	UTSW	16	21217235	missense	probably damaging	0.99
R1928:Ephb3	UTSW	16	21222295	missense	possibly damaging	0.86
R1956:Ephb3	UTSW	16	21221382	missense	probably damaging	1.00
R2378:Ephb3	UTSW	16	21218243	missense	probably benign
R3408:Ephb3	UTSW	16	21219504	missense	probably damaging	0.99
R4027:Ephb3	UTSW	16	21221697	missense	probably damaging	1.00
R4429:Ephb3	UTSW	16	21214463	missense	probably damaging	1.00
R4655:Ephb3	UTSW	16	21222208	missense	probably damaging	0.98
R4826:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4828:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4960:Ephb3	UTSW	16	21220495	missense	probably benign	0.09
R5057:Ephb3	UTSW	16	21220447	missense	probably damaging	1.00
R5090:Ephb3	UTSW	16	21214487	missense	probably damaging	1.00
R5396:Ephb3	UTSW	16	21219105	missense	possibly damaging	0.91
R5540:Ephb3	UTSW	16	21220860	missense	probably damaging	1.00
R5628:Ephb3	UTSW	16	21218119	missense	probably damaging	1.00
R5666:Ephb3	UTSW	16	21222491	missense	probably benign	0.08
R5838:Ephb3	UTSW	16	21221687	missense	probably damaging	1.00
R5866:Ephb3	UTSW	16	21211379	intron	probably benign
R6017:Ephb3	UTSW	16	21222031	missense	probably damaging	1.00
R6020:Ephb3	UTSW	16	21222013	missense	probably damaging	0.99
R6510:Ephb3	UTSW	16	21218111	missense	probably damaging	0.98
R6591:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R6691:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R7101:Ephb3	UTSW	16	21218518	missense	possibly damaging	0.86
R7111:Ephb3	UTSW	16	21218827	nonsense	probably null
R7236:Ephb3	UTSW	16	21214481	missense	probably damaging	1.00
R7307:Ephb3	UTSW	16	21222226	missense	probably benign	0.04
R7410:Ephb3	UTSW	16	21221408	missense	possibly damaging	0.75
R7413:Ephb3	UTSW	16	21214707	missense	probably damaging	1.00
R7452:Ephb3	UTSW	16	21217357	splice site	probably null
R7944:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R7945:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
Z1176:Ephb3	UTSW	16	21218036	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- TTCACGGTCATCCAGCTTGTG -3'
(R):5'- ACATCGCTGGCAGACGTAAAC -3'

Sequencing Primer
(F):5'- CCAGCTTGTGGGCATGTTAC -3'
(R):5'- TGGCAGACGTAAACTTCCG -3'

Posted On

2018-06-06