Incidental Mutation 'R6515:Ifit1bl1'
ID520642
Institutional Source Beutler Lab
Gene Symbol Ifit1bl1
Ensembl Gene ENSMUSG00000079339
Gene Nameinterferon induced protein with tetratricpeptide repeats 1B like 1
SynonymsGm14446
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6515 (G1)
Quality Score144.008
Status Validated
Chromosome19
Chromosomal Location34592888-34601968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34594499 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 186 (Y186C)
Ref Sequence ENSEMBL: ENSMUSP00000132781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]
Predicted Effect probably damaging
Transcript: ENSMUST00000112467
AA Change: Y186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: Y186C

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168254
AA Change: Y186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: Y186C

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Meta Mutation Damage Score 0.3729 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Pnlip T C 19: 58,673,115 S79P probably damaging Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Ifit1bl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Ifit1bl1 UTSW 19 34594015 missense possibly damaging 0.79
R0420:Ifit1bl1 UTSW 19 34594514 missense probably damaging 1.00
R1161:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1310:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1483:Ifit1bl1 UTSW 19 34594641 missense possibly damaging 0.88
R1606:Ifit1bl1 UTSW 19 34594044 missense probably benign 0.00
R1753:Ifit1bl1 UTSW 19 34593860 missense probably benign 0.15
R1778:Ifit1bl1 UTSW 19 34594193 missense probably damaging 1.00
R2204:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2205:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2442:Ifit1bl1 UTSW 19 34594889 missense probably benign 0.00
R2858:Ifit1bl1 UTSW 19 34594322 missense probably benign 0.01
R3422:Ifit1bl1 UTSW 19 34593950 missense probably benign 0.04
R4081:Ifit1bl1 UTSW 19 34594640 missense possibly damaging 0.63
R4125:Ifit1bl1 UTSW 19 34594788 missense probably damaging 0.99
R4616:Ifit1bl1 UTSW 19 34594610 missense probably damaging 1.00
R4731:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4732:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4849:Ifit1bl1 UTSW 19 34594676 missense probably damaging 1.00
R5026:Ifit1bl1 UTSW 19 34593893 missense probably damaging 1.00
R5049:Ifit1bl1 UTSW 19 34594081 nonsense probably null
R5414:Ifit1bl1 UTSW 19 34593924 missense probably damaging 0.99
R5561:Ifit1bl1 UTSW 19 34593797 nonsense probably null
R5586:Ifit1bl1 UTSW 19 34594277 missense probably damaging 0.98
R6345:Ifit1bl1 UTSW 19 34594170 nonsense probably null
R6382:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R7073:Ifit1bl1 UTSW 19 34599267 critical splice donor site probably null
R7180:Ifit1bl1 UTSW 19 34593902 missense probably damaging 1.00
R7210:Ifit1bl1 UTSW 19 34594164 missense probably benign 0.00
R7665:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R7724:Ifit1bl1 UTSW 19 34594005 missense probably benign 0.00
R7783:Ifit1bl1 UTSW 19 34593936 missense probably benign 0.01
R7944:Ifit1bl1 UTSW 19 34593824 missense probably benign 0.00
R8251:Ifit1bl1 UTSW 19 34594832 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATCCTGGGCAGAGTTTCTTC -3'
(R):5'- ATTACCACAGGGGCAGCTTG -3'

Sequencing Primer
(F):5'- CCTGGGCAGAGTTTCTTCAATGTG -3'
(R):5'- GCAGAAGCCCAGGTCTAC -3'
Posted On2018-06-06