Incidental Mutation 'R6539:Olfr194'
ID520643
Institutional Source Beutler Lab
Gene Symbol Olfr194
Ensembl Gene ENSMUSG00000063020
Gene Nameolfactory receptor 194
SynonymsMOR182-13, MOR182-7P, GA_x54KRFPKG5P-55348161-55347241
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59116537-59121069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59119751 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 106 (S106R)
Ref Sequence ENSEMBL: ENSMUSP00000149379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072608] [ENSMUST00000213228] [ENSMUST00000216519]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072608
AA Change: S106R

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072407
Gene: ENSMUSG00000063020
AA Change: S106R

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.7e-47 PFAM
Pfam:7tm_1 40 289 1.9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213228
AA Change: S106R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216519
AA Change: S106R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Olfr194
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Olfr194 APN 16 59119573 missense possibly damaging 0.94
IGL02098:Olfr194 APN 16 59120070 utr 5 prime probably benign
IGL02276:Olfr194 APN 16 59120015 missense probably benign 0.01
IGL03122:Olfr194 APN 16 59119438 missense probably benign 0.00
R0781:Olfr194 UTSW 16 59119824 missense probably damaging 0.97
R1162:Olfr194 UTSW 16 59119372 missense probably damaging 0.99
R1526:Olfr194 UTSW 16 59119930 missense probably damaging 1.00
R1654:Olfr194 UTSW 16 59119689 missense possibly damaging 0.50
R4379:Olfr194 UTSW 16 59119664 missense probably benign 0.22
R4380:Olfr194 UTSW 16 59119664 missense probably benign 0.22
R5768:Olfr194 UTSW 16 59119972 small deletion probably benign
R5771:Olfr194 UTSW 16 59119972 small deletion probably benign
R5942:Olfr194 UTSW 16 59119676 nonsense probably null
R6131:Olfr194 UTSW 16 59119893 missense probably damaging 1.00
R6621:Olfr194 UTSW 16 59119924 missense probably benign 0.19
R7642:Olfr194 UTSW 16 59119648 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAGAGTGGCAGGATCTCACAG -3'
(R):5'- GGAAGGATCCTCATCTTCACAC -3'

Sequencing Primer
(F):5'- GCAGGATCTCACAGTAAAAATGATC -3'
(R):5'- ACACCCATGTACTATTTCCTTGGAAG -3'
Posted On2018-06-06