Incidental Mutation 'R6515:Pnlip'
ID520645
Institutional Source Beutler Lab
Gene Symbol Pnlip
Ensembl Gene ENSMUSG00000046008
Gene Namepancreatic lipase
Synonymspancreatic triglyceride lipase, PTL, 1810007A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6515 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location58670365-58681786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58673115 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 79 (S79P)
Ref Sequence ENSEMBL: ENSMUSP00000056377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057270]
Predicted Effect probably damaging
Transcript: ENSMUST00000057270
AA Change: S79P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056377
Gene: ENSMUSG00000046008
AA Change: S79P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipase 17 352 2.4e-164 PFAM
LH2 355 465 4.47e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipase family of proteins. The encoded enzyme is secreted by the pancreas and hydrolyzes triglycerides in the small intestine, and is essential for the efficient digestion of dietary fats. Inhibition of the encoded enzyme may prevent high-fat diet-induced obesity in mice and result in weight loss in human patients with obesity. Mutations in this gene cause congenital pancreatic lipase deficiency, a rare disorder characterized by steatorrhea. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice show impaired dietary cholesterol, triglyceride and retinyl ester absorption, resistance to diet-induced obesity, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik G A 16: 13,676,956 probably benign Het
Ap1s3 T C 1: 79,614,327 D102G probably damaging Het
Apcdd1 T A 18: 62,951,839 M369K probably damaging Het
Atp4a A G 7: 30,712,478 K46R possibly damaging Het
Bcl9l A G 9: 44,507,874 probably null Het
Cabyr A G 18: 12,754,283 S324G possibly damaging Het
Casp8ap2 A G 4: 32,646,423 D1832G possibly damaging Het
Cdk4 C T 10: 127,066,183 P256S probably null Het
Cnot6l C A 5: 96,161,678 probably benign Het
Cox17 C A 16: 38,347,195 A32E probably damaging Het
Cyp27b1 G T 10: 127,048,250 probably benign Het
Enpp2 T A 15: 54,860,093 N628I possibly damaging Het
Ggcx T C 6: 72,425,832 C258R probably benign Het
Gm4869 T C 5: 140,495,024 S970P possibly damaging Het
Hbb-bh1 T C 7: 103,842,767 D80G probably damaging Het
Hoxb5 A T 11: 96,305,082 D252V probably damaging Het
Hspa4l A G 3: 40,781,582 D545G possibly damaging Het
Hspa5 T A 2: 34,772,404 V28E probably benign Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Klra17 A T 6: 129,831,499 I257N probably damaging Het
Megf6 C T 4: 154,258,919 H662Y possibly damaging Het
Mfsd6 T C 1: 52,660,961 K676R probably damaging Het
Nutm1 A C 2: 112,256,320 L22R probably benign Het
Oas1f T C 5: 120,848,434 V150A probably damaging Het
Olfr1318 T C 2: 112,156,365 L138P probably benign Het
Olfr1337 T C 4: 118,782,270 Y105C probably benign Het
Pik3ap1 A G 19: 41,376,146 Y45H probably benign Het
Ppfia3 T C 7: 45,340,233 D1185G possibly damaging Het
Rbm34 A T 8: 126,961,932 S217T possibly damaging Het
Rbm44 T C 1: 91,165,138 I820T probably damaging Het
Rnf151 A T 17: 24,716,417 L180Q probably benign Het
Sec24d G A 3: 123,343,070 R484Q possibly damaging Het
Spop C A 11: 95,485,935 D271E possibly damaging Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Thap12 A G 7: 98,707,095 E63G probably damaging Het
Thsd7a T A 6: 12,501,086 T441S possibly damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tmem184a A G 5: 139,808,438 F177L probably benign Het
Uggt2 A T 14: 119,077,719 S313T possibly damaging Het
Unc13a A G 8: 71,647,940 I1068T probably benign Het
Xirp1 T C 9: 120,016,917 R967G probably benign Het
Other mutations in Pnlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Pnlip APN 19 58673874 missense probably benign 0.00
IGL02733:Pnlip APN 19 58680788 missense probably benign
R1121:Pnlip UTSW 19 58680908 splice site probably null
R2145:Pnlip UTSW 19 58676444 missense probably benign 0.11
R2213:Pnlip UTSW 19 58673770 missense probably benign 0.07
R3405:Pnlip UTSW 19 58680759 missense probably benign
R4703:Pnlip UTSW 19 58676467 missense probably damaging 1.00
R4731:Pnlip UTSW 19 58676487 missense probably benign 0.00
R4909:Pnlip UTSW 19 58676240 missense possibly damaging 0.85
R5386:Pnlip UTSW 19 58679607 missense probably benign 0.25
R5444:Pnlip UTSW 19 58673163 missense probably benign 0.00
R5851:Pnlip UTSW 19 58673792 nonsense probably null
R6605:Pnlip UTSW 19 58671742 missense probably benign 0.20
R6974:Pnlip UTSW 19 58679635 critical splice donor site probably null
R7057:Pnlip UTSW 19 58676263 missense probably damaging 1.00
R7312:Pnlip UTSW 19 58681702 missense probably damaging 0.97
R7358:Pnlip UTSW 19 58676544 missense probably damaging 1.00
R7476:Pnlip UTSW 19 58679634 critical splice donor site probably null
R7674:Pnlip UTSW 19 58675154 missense possibly damaging 0.70
R7800:Pnlip UTSW 19 58681702 missense probably benign 0.18
R7983:Pnlip UTSW 19 58680059 missense probably benign 0.04
X0025:Pnlip UTSW 19 58680810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCAACTTGGGAATGGCTG -3'
(R):5'- ATACCCTAAGTGTCCCAGGAC -3'

Sequencing Primer
(F):5'- CAACTTGGGAATGGCTGTCAATG -3'
(R):5'- AAGTGTCCCAGGACCCTTGTG -3'
Posted On2018-06-06