Incidental Mutation 'R6516:Slc25a12'
ID520655
Institutional Source Beutler Lab
Gene Symbol Slc25a12
Ensembl Gene ENSMUSG00000027010
Gene Namesolute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6516 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location71271063-71367749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71324083 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 81 (Y81C)
Ref Sequence ENSEMBL: ENSMUSP00000139371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151937] [ENSMUST00000184169]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137916
Predicted Effect probably benign
Transcript: ENSMUST00000151937
AA Change: I120V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122103
Gene: ENSMUSG00000027010
AA Change: I120V

DomainStartEndE-ValueType
EFh 56 84 1.83e1 SMART
EFh 90 118 5.8e-1 SMART
EFh 161 189 2.49e0 SMART
Pfam:Mito_carr 324 421 3e-27 PFAM
Pfam:Mito_carr 422 513 2.9e-18 PFAM
Pfam:Mito_carr 515 609 2.1e-27 PFAM
low complexity region 662 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184169
AA Change: Y81C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139371
Gene: ENSMUSG00000027010
AA Change: Y81C

DomainStartEndE-ValueType
SCOP:d1irja_ 3 71 5e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding mitochondrial carrier protein. The encoded protein localizes to the mitochondria and is involved in the exchange of aspartate for glutamate across the inner mitochondrial membrane. Polymorphisms in this gene may be associated with autism, and mutations in this gene may also be a cause of global cerebral hypomyelination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele show severe growth defects, generalized tremors, postnatal lethality, impaired motor coordination, and CNS dysmyelination associated with decreased synthesis of myelin lipids and a striking reduction in brain aspartate and N-acetylaspartate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,952,666 V93E probably benign Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
Adcy8 A T 15: 64,699,387 Y1136N probably damaging Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 R43W probably damaging Het
Ano8 G T 8: 71,481,780 probably null Het
Arhgap31 A G 16: 38,609,404 F370L possibly damaging Het
C7 A G 15: 5,057,081 V26A probably damaging Het
Clec4a2 C A 6: 123,139,406 Q153K probably damaging Het
Cyp2c67 T A 19: 39,617,429 D341V probably damaging Het
Ddo T A 10: 40,631,745 V46E probably damaging Het
Deup1 A C 9: 15,610,614 M85R probably damaging Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah2 A G 11: 69,465,386 F2147L probably benign Het
Dock10 T C 1: 80,540,461 E1298G probably damaging Het
Dock4 T A 12: 40,731,899 V701E possibly damaging Het
Dthd1 A T 5: 62,839,264 K447N probably benign Het
Eno2 G T 6: 124,761,709 probably null Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Gm10020 A G 15: 52,477,804 noncoding transcript Het
Gpbp1 A T 13: 111,453,102 H111Q probably benign Het
Grk3 A T 5: 112,961,549 probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Kcnc2 A G 10: 112,462,000 T610A probably benign Het
Kcnh1 T A 1: 192,418,781 D560E possibly damaging Het
Klc4 A T 17: 46,642,255 N116K probably damaging Het
Krba1 C T 6: 48,413,272 Q656* probably null Het
Mchr1 A G 15: 81,237,868 Y273C probably damaging Het
Myh15 T A 16: 49,137,633 C938S probably benign Het
Nutm1 T C 2: 112,251,217 E367G probably damaging Het
Odf3 G A 7: 140,848,805 G128S probably damaging Het
Olfr1143 A T 2: 87,802,770 Y127F possibly damaging Het
Olfr1509 A T 14: 52,451,129 T239S probably damaging Het
Olfr519 A T 7: 108,893,765 I214K probably damaging Het
Olfr912 A G 9: 38,581,472 N65S probably damaging Het
Pikfyve G T 1: 65,265,781 M1697I probably benign Het
Plcd1 A G 9: 119,076,203 S147P probably damaging Het
Plin3 G A 17: 56,286,223 P113L probably damaging Het
Pum3 C A 19: 27,426,008 S31I probably benign Het
Robo1 T C 16: 73,024,353 V1327A probably benign Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Scnn1b T C 7: 121,912,112 S341P probably damaging Het
Sh3bp5 A T 14: 31,375,672 M362K possibly damaging Het
Slc24a5 A G 2: 125,088,107 T443A probably benign Het
Slc43a3 A G 2: 84,957,761 T496A probably benign Het
Smap2 C T 4: 120,983,106 probably null Het
Sptbn5 T A 2: 120,047,950 probably benign Het
Taar5 A G 10: 23,971,666 S321G possibly damaging Het
Tbx21 T C 11: 97,099,956 I299V possibly damaging Het
Tcerg1 T C 18: 42,530,892 probably null Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Tmem176a T G 6: 48,844,068 probably null Het
Tmem236 T C 2: 14,195,980 S119P probably benign Het
Tmprss11a C T 5: 86,420,128 V247M probably damaging Het
Tnks1bp1 T C 2: 85,070,727 S1593P probably damaging Het
Ttc9b T A 7: 27,655,987 D227E probably benign Het
Usp33 A C 3: 152,373,416 Q435P probably benign Het
Vti1a C T 19: 55,380,958 A94V probably damaging Het
Wdr3 A G 3: 100,145,676 Y587H probably damaging Het
Wwc1 G A 11: 35,867,302 A739V probably benign Het
Zfp628 C G 7: 4,920,202 Y474* probably null Het
Zfp820 A T 17: 21,819,373 C325S probably damaging Het
Other mutations in Slc25a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Slc25a12 APN 2 71344032 missense possibly damaging 0.63
IGL01116:Slc25a12 APN 2 71293352 splice site probably benign
IGL01375:Slc25a12 APN 2 71308050 splice site probably benign
IGL02631:Slc25a12 APN 2 71296742 missense possibly damaging 0.90
IGL02899:Slc25a12 APN 2 71279635 missense probably damaging 1.00
R0031:Slc25a12 UTSW 2 71333614 missense possibly damaging 0.93
R0689:Slc25a12 UTSW 2 71311493 missense possibly damaging 0.95
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1832:Slc25a12 UTSW 2 71333710 missense possibly damaging 0.85
R2044:Slc25a12 UTSW 2 71312548 missense probably benign 0.00
R4537:Slc25a12 UTSW 2 71275106 utr 3 prime probably benign
R4668:Slc25a12 UTSW 2 71315062 missense probably benign 0.22
R4830:Slc25a12 UTSW 2 71296805 missense probably damaging 1.00
R5476:Slc25a12 UTSW 2 71275322 missense probably benign
R5698:Slc25a12 UTSW 2 71282573 missense probably damaging 1.00
R6074:Slc25a12 UTSW 2 71276454 missense probably benign 0.01
R7270:Slc25a12 UTSW 2 71324025 missense probably benign
R7794:Slc25a12 UTSW 2 71311508 missense probably damaging 1.00
R8022:Slc25a12 UTSW 2 71275189 missense unknown
Z1176:Slc25a12 UTSW 2 71296746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGAGCTTGCTTCCATGAGAG -3'
(R):5'- ATGGGTTTCTGGGCACAAAGAG -3'

Sequencing Primer
(F):5'- CTTGCTTCCATGAGAGGGGAATG -3'
(R):5'- GGCACAAAGAGATTTGCAGTTCCTC -3'
Posted On2018-06-06